Darwin Core Data Package - Quick Reference Guide

This Quick Reference Guide provides an navigable overview of tables and available fields for a Darwin Core Data Package (DwC-DP). The sidebar at the right provides quick access to table definitions. Within the table definitions, the possible fields in the table and their definitions are listed.

Event

Identifier: http://rs.tdwg.org/dwc/dwc-dp/event

Description: An action, process, or set of circumstances occurring at a dcterms:Location during a period of time.

Examples:

`a material collecting event`

`a bird observation`

`a camera trap image capture`

`an organism occurrence`

`a biotic survey`

Relationships to Other Tables

Field	Target Table	Target Field	Required
parentEventID	event	eventID	No
eventConductedByID	agent	agentID	No
georeferencedByID	agent	agentID	No
georeferenceProtocolID	protocol	protocolID	No
fundingAttributionID	agent	agentID	No

eventID

Title (Label)	Event ID
Namespace	dwc
Table:	Event
IRI	http://rs.tdwg.org/dwc/terms/eventID
Description	An identifier for a dwc:Event.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': True}
Format	default

parentEventID

Title (Label)	Parent Event ID
Namespace	dwc
Table:	Event
IRI	http://rs.tdwg.org/dwc/terms/parentEventID
Description	An identifier for a broader dwc:Event that groups this and potentially other dwc:Events.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Format	default

preferredEventName

Title (Label)	Preferred Event Name
Namespace	dwcdp
Table:	Event
Description	The name of a dwc:Event preferred in searches and results.
Type	string
Format	default

eventCategory

Title (Label)	Event Category
Namespace	dwcdp
Table:	Event
Description	A broad category that best matches the nature of a dwc:Event.
Comments	Recommended best practice is to use a limited, tightly controlled vocabulary.
Examples	`observation` `material gathering` `organism interaction` `survey` `nucleotide analysis`
Type	string
Format	default

eventType

Title (Label)	Event Type
Namespace	dwc
Table:	Event
IRI	http://rs.tdwg.org/dwc/terms/eventType
Description	A narrow category that best matches the nature of a dwc:Event.
Comments	Recommended best practice is to use a controlled vocabulary.
Examples	`MaterialGathering` `Occurrence` `Survey` `SiteVisit` `OrganismInteraction` `CameraTrapDeployment` `MediaCapture`
Type	string
Format	default

datasetName

Title (Label)	Dataset Name
Namespace	dwc
Table:	Event
IRI	http://rs.tdwg.org/dwc/terms/datasetName
Description	A name of a dataset from which data originated.
Type	string
Format	default

datasetID

Title (Label)	Dataset ID
Namespace	dwc
Table:	Event
IRI	http://rs.tdwg.org/dwc/terms/datasetID
Description	An identifier for a dataset from which data originated.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Format	default

fieldNumber

Title (Label)	Field Number
Namespace	dwc
Table:	Event
IRI	http://rs.tdwg.org/dwc/terms/fieldNumber
Description	An identifier given to a dwc:Event in the field.
Comments	Often serves as a link between field notes and a dwc:Event.
Examples	`RV Sol 87-03-08`
Type	string
Format	default

eventConductedBy

Title (Label)	Event Conducted By
Namespace	dwc
Table:	Event
IRI	http://rs.tdwg.org/dwc/terms/recordedBy
Description	A list (concatenated and separated) of names of Agents responsible for conducting or recording a dwc:Event.
Comments	Recommended best practice is to separate the values in a list with space vertical bar space ( \| ).
Examples	`José E. Crespo` `Oliver P. Pearson \| Anita K. Pearson` `FMNH`
Type	string
Format	default

eventConductedByID

Title (Label)	Event Conducted By ID
Namespace	dwc
Table:	Event
IRI	http://rs.tdwg.org/dwc/terms/recordedByID
Description	An identifier for the Agent responsible for conducting or recording a dwc:Event.
Comments	Recommended best practice is to use a globally unique identifier.
Examples	`https://orcid.org/0000-0002-1825-0097` `https://ror.org/00mh9zx15`
Type	string
Format	default

eventDate

Title (Label)	Event Date
Namespace	dwc
Table:	Event
IRI	http://rs.tdwg.org/dwc/terms/eventDate
Description	A date or time interval during which a dwc:Event occurred.
Comments	For gathering dwc:Events, this is the date-time when the gathering took place.
Examples	`1963-03-08T14:07-06:00` (8 Mar 1963 at 2:07pm in the time zone six hours earlier than UTC) `2009-02-20T08:40Z` (20 February 2009 8:40am UTC) `2018-08-29T15:19` (3:19pm local time on 29 August 2018) `1809-02-12` (some time during 12 February 1809) `1906-06` (some time in June 1906) `1971` (some time in the year 1971) `2007-03-01T13:00:00Z/2008-05-11T15:30:00Z` (some time during the interval between 1 March 2007 1pm UTC and 11 May 2008 3:30pm UTC) `1900/1909` (some time during the interval between the beginning of the year 1900 and the end of the year 1909) `2007-11-13/15` (some time in the interval between 13 November 2007 and 15 November 2007)
Type	string
Format	default

eventTime

Title (Label)	Event Time
Namespace	dwc
Table:	Event
IRI	http://rs.tdwg.org/dwc/terms/eventTime
Description	A time interval during which a dwc:Event occurred.
Comments	Recommended best practice is to use a time of day that conforms to ISO 8601-1:2019.
Examples	`14:07-06:00` (2:07pm in the time zone six hours earlier than UTC) `08:40:21Z` (8:40:21am UTC) `13:00:00Z/15:30:00Z` (the interval between 1pm UTC and 3:30pm UTC)
Type	string
Format	default

startDayOfYear

Title (Label)	Start Day Of Year
Namespace	dwc
Table:	Event
IRI	http://rs.tdwg.org/dwc/terms/startDayOfYear
Description	The earliest integer day of the year on which a dwc:Event occurred (1 for January 1, 365 for December 31, except in a leap year, in which case it is 366).
Examples	`1` (1 January) `32` (1 February) `366` (31 December) `365` (30 December in a leap year, 31 December in a non-leap year)
Type	integer
Constraints	{'required': False, 'minimum': 1, 'maximum': 366}
Format	default

endDayOfYear

Title (Label)	End Day Of Year
Namespace	dwc
Table:	Event
IRI	http://rs.tdwg.org/dwc/terms/endDayOfYear
Description	The latest integer day of the year on which a dwc:Event occurred (1 for January 1, 365 for December 31, except in a leap year, in which case it is 366).
Examples	`1` (1 January) `32` (1 February) `366` (31 December) `365` (30 December in a leap year, 31 December in a non-leap year)
Type	integer
Constraints	{'required': False, 'minimum': 1, 'maximum': 366}
Format	default

year

Title (Label)	Year
Namespace	dwc
Table:	Event
IRI	http://rs.tdwg.org/dwc/terms/year
Description	A four-digit year in which a dwc:Event occurred, according to the Common Era Calendar.
Examples	`1160` `2008`
Type	integer
Format	default

month

Title (Label)	Month
Namespace	dwc
Table:	Event
IRI	http://rs.tdwg.org/dwc/terms/month
Description	An integer month in which a dwc:Event occurred.
Examples	`1` (January) `10` (October)
Type	integer
Constraints	{'required': False, 'minimum': 1, 'maximum': 12}
Format	default

day

Title (Label)	Day
Namespace	dwc
Table:	Event
IRI	http://rs.tdwg.org/dwc/terms/day
Description	An integer day of the month on which a dwc:Event occurred.
Examples	`9` `28`
Type	integer
Constraints	{'required': False, 'minimum': 1, 'maximum': 31}
Format	default

verbatimEventDate

Title (Label)	Verbatim Event Date
Namespace	dwc
Table:	Event
IRI	http://rs.tdwg.org/dwc/terms/verbatimEventDate
Description	A verbatim original representation of the date and time information for a dwc:Event.
Examples	`spring 1910` `marzo 2002` `1999-03-XX` `17IV1934`
Type	string
Format	default

verbatimLocality

Title (Label)	Verbatim Locality
Namespace	dwc
Table:	Event
IRI	http://rs.tdwg.org/dwc/terms/verbatimLocality
Description	An original textual description of a dcterms:Location.
Examples	`25 km NNE Bariloche por R. Nac. 237`
Type	string
Format	default

verbatimElevation

Title (Label)	Verbatim Elevation
Namespace	dwc
Table:	Event
IRI	http://rs.tdwg.org/dwc/terms/verbatimElevation
Description	An original description of the elevation (altitude, usually above sea level) of a dcterms:Location.
Examples	`100-200 m`
Type	string
Format	default

verbatimDepth

Title (Label)	Verbatim Depth
Namespace	dwc
Table:	Event
IRI	http://rs.tdwg.org/dwc/terms/verbatimDepth
Description	An original description of the depth below a local surface.
Examples	`100-200 m`
Type	string
Format	default

verbatimCoordinates

Title (Label)	Verbatim Coordinates
Namespace	dwc
Table:	Event
IRI	http://rs.tdwg.org/dwc/terms/verbatimCoordinates
Description	Verbatim original spatial coordinates of a dcterms:Location.
Comments	The coordinate ellipsoid, geodeticDatum, or full Spatial Reference System (SRS) for these coordinates should be stored in verbatimSRS and the coordinate system should be stored in verbatimCoordinateSystem.
Examples	`41 05 54S 121 05 34W` `17T 630000 4833400`
Type	string
Format	default

verbatimLatitude

Title (Label)	Verbatim Latitude
Namespace	dwc
Table:	Event
IRI	http://rs.tdwg.org/dwc/terms/verbatimLatitude
Description	A verbatim original latitude of a dcterms:Location.
Comments	The coordinate ellipsoid, geodeticDatum, or full Spatial Reference System (SRS) for these coordinates should be stored in verbatimSRS and the coordinate system should be stored in verbatimCoordinateSystem.
Examples	`41 05 54.03S`
Type	string
Format	default

verbatimLongitude

Title (Label)	Verbatim Longitude
Namespace	dwc
Table:	Event
IRI	http://rs.tdwg.org/dwc/terms/verbatimLongitude
Description	A verbatim original longitude of a dcterms:Location.
Comments	The coordinate ellipsoid, geodeticDatum, or full Spatial Reference System (SRS) for these coordinates should be stored in verbatimSRS and the coordinate system should be stored in verbatimCoordinateSystem.
Examples	`121d 10' 34 W`
Type	string
Format	default

verbatimCoordinateSystem

Title (Label)	Verbatim Coordinate System
Namespace	dwc
Table:	Event
IRI	http://rs.tdwg.org/dwc/terms/verbatimCoordinateSystem
Description	A coordinate format for dwc:verbatimLatitude and dwc:verbatimLongitude or dwc:verbatimCoordinates.
Comments	Recommended best practice is to use a controlled vocabulary.
Examples	`decimal degrees` `degrees decimal minutes` `degrees minutes seconds` `UTM`
Type	string
Format	default

verbatimSRS

Title (Label)	Verbatim SRS
Namespace	dwc
Table:	Event
IRI	http://rs.tdwg.org/dwc/terms/verbatimSRS
Description	An ellipsoid, geodetic datum, or spatial reference system (SRS) upon which coordinates given in dwc:verbatimLatitude and dwc:verbatimLongitude, or dwc:verbatimCoordinates are based.
Comments	Recommended best practice is to use the EPSG code of the SRS, if known. Otherwise use a controlled vocabulary for the name or code of the geodetic datum, if known. Otherwise use a controlled vocabulary for the name or code of the ellipsoid, if known. If none of these is known, use the value `not recorded`.
Examples	`not recorded` `EPSG:4326` `WGS84` `NAD27` `Campo Inchauspe` `European 1950` `Clarke 1866`
Type	string
Format	default

georeferenceVerificationStatus

Title (Label)	Georeference Verification Status
Namespace	dwc
Table:	Event
IRI	http://rs.tdwg.org/dwc/terms/georeferenceVerificationStatus
Description	A categorical description of the extent to which a georeference has been verified to represent the best possible spatial description for a dcterms:Location.
Comments	Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`unable to georeference` `requires georeference` `requires verification` `verified by data custodian` `verified by contributor`
Type	string
Format	default

habitat

Title (Label)	Habitat
Namespace	dwc
Table:	Event
IRI	http://rs.tdwg.org/dwc/terms/habitat
Description	A category or description of the habitat in which a dwc:Event occurred.
Examples	`oak savanna` `pre-cordilleran steppe`
Type	string
Format	default

eventEffort

Title (Label)	Event Effort
Namespace	eco
Table:	Event
IRI	http://rs.tdwg.org/eco/terms/eventEffort
Description	An amount of effort expended during a dwc:Event.
Examples	`40 trap-nights` `10 observer-hours` `10 km by foot` `30 km by car`
Type	string
Format	default

fieldNotes

Title (Label)	Field Notes
Namespace	dwc
Table:	Event
IRI	http://rs.tdwg.org/dwc/terms/fieldNotes
Description	One of a) an indicator of the existence of, b) a reference to (publication, URI), or c) the text of notes taken in the field about a dwc:Event.
Examples	`Notes available in the Grinnell-Miller Library.`
Type	string
Format	default

eventReferences

Title (Label)	Event References
Namespace	dwcdp
Table:	Event
Description	A list (concatenated and separated) of identifiers (publication, bibliographic reference, global unique identifier, URI) of literature associated with a dwc:Event.
Comments	Recommended best practice is to separate the values in a list with space vertical bar space (` \| `).
Examples	`http://www.sciencemag.org/cgi/content/abstract/322/5899/261` `Christopher J. Conroy, Jennifer L. Neuwald. 2008. Phylogeographic study of the California vole, Microtus californicus Journal of Mammalogy, 89(3):755-767.` `Steven R. Hoofer and Ronald A. Van Den Bussche. 2001. Phylogenetic Relationships of Plecotine Bats and Allies Based on Mitochondrial Ribosomal Sequences. Journal of Mammalogy 82(1):131-137. \| Walker, Faith M., Jeffrey T. Foster, Kevin P. Drees, Carol L. Chambers. 2014. Spotted bat (Euderma maculatum) microsatellite discovery using illumina sequencing. Conservation Genetics Resources.`
Type	string
Format	default

eventRemarks

Title (Label)	Event Remarks
Namespace	dwc
Table:	Event
IRI	http://rs.tdwg.org/dwc/terms/eventRemarks
Description	Comments or notes about a dwc:Event.
Examples	`After the recent rains the river is nearly at flood stage.`
Type	string
Format	default

locationID

Title (Label)	Location ID
Namespace	dwc
Table:	Event
IRI	http://rs.tdwg.org/dwc/terms/locationID
Description	An identifier a dcterms:Location.
Comments	Recommended best practice is to use a globally unique identifier.
Examples	`https://opencontext.org/subjects/768A875F-E205-4D0B-DE55-BAB7598D0FD1`
Type	string
Format	default

higherGeographyID

Title (Label)	Higher Geography ID
Namespace	dwc
Table:	Event
IRI	http://rs.tdwg.org/dwc/terms/higherGeographyID
Description	An identifier for a geographic region within which a dcterms:Location occurs.
Comments	Recommended best practice is to use a globally unique identifier.
Examples	`http://vocab.getty.edu/tgn/1002002` (Antártida e Islas del Atlántico Sur, Territorio Nacional de la Tierra del Fuego, Argentina).
Type	string
Format	default

higherGeography

Title (Label)	Higher Geography
Namespace	dwc
Table:	Event
IRI	http://rs.tdwg.org/dwc/terms/higherGeography
Description	A list (concatenated and separated) of geographic names less specific than the information captured in dwc:locality.
Comments	Recommended best practice is to separate the values in a list with space vertical bar space (` \| `), with terms in order from least specific to most specific.
Examples	`North Atlantic Ocean` `South America \| Argentina \| Patagonia \| Parque Nacional Nahuel Huapi \| Neuquén \| Los Lagos` with accompanying values `South America` (continent) `Argentina` (country), `Neuquén` (first order division), and `Los Lagos` (second order division)
Type	string
Format	default

continent

Title (Label)	Continent
Namespace	dwc
Table:	Event
IRI	http://rs.tdwg.org/dwc/terms/continent
Description	A name of a continent in which a dcterms:Location occurs.
Comments	Recommended best practice is to use a controlled vocabulary such as the Getty Thesaurus of Geographic Names. Recommended best practice is to leave this field blank if the dcterms:Location spans multiple entities at this administrative level or if the dcterms:Location might be in one or another of multiple possible entities at this level. Multiplicity and uncertainty of the geographic entity can be captured either in the term dwc:higherGeography or in the term dwc:locality, or both.
Examples	`Africa` `Antarctica` `Asia` `Europe` `North America` `Oceania` `South America`
Type	string
Format	default

waterBody

Title (Label)	Water Body
Namespace	dwc
Table:	Event
IRI	http://rs.tdwg.org/dwc/terms/waterBody
Description	A name of a water body in which a dcterms:Location occurs.
Comments	Recommended best practice is to use a controlled vocabulary such as the Getty Thesaurus of Geographic Names.
Examples	`Indian Ocean` `Baltic Sea` `Hudson River` `Lago Nahuel Huapi`
Type	string
Format	default

islandGroup

Title (Label)	Island Group
Namespace	dwc
Table:	Event
IRI	http://rs.tdwg.org/dwc/terms/islandGroup
Description	A name of an island group in which a dcterms:Location occurs.
Comments	Recommended best practice is to use a controlled vocabulary such as the Getty Thesaurus of Geographic Names.
Examples	`Alexander Archipelago` `Archipiélago Diego Ramírez` `Seychelles`
Type	string
Format	default

island

Title (Label)	Island
Namespace	dwc
Table:	Event
IRI	http://rs.tdwg.org/dwc/terms/island
Description	A name of an island on or near which a dcterms:Location occurs.
Comments	Recommended best practice is to use a controlled vocabulary such as the Getty Thesaurus of Geographic Names.
Examples	`Nosy Be` `Bikini Atoll` `Vancouver` `Viti Levu` `Zanzibar`
Type	string
Format	default

country

Title (Label)	Country
Namespace	dwc
Table:	Event
IRI	http://rs.tdwg.org/dwc/terms/country
Description	A name of a country or major administrative unit in which a dcterms:Location occurs.
Comments	Recommended best practice is to use a controlled vocabulary such as the Getty Thesaurus of Geographic Names. Recommended best practice is to leave this field blank if the dcterms:Location spans multiple entities at this administrative level or if the dcterms:Location might be in one or another of multiple possible entities at this level. Multiplicity and uncertainty of the geographic entity can be captured either in the term dwc:higherGeography or in the term dwc:locality, or both.
Examples	`Denmark` `Colombia` `España`
Type	string
Format	default

countryCode

Title (Label)	Country Code
Namespace	dwc
Table:	Event
IRI	http://rs.tdwg.org/dwc/terms/countryCode
Description	A standard code for a country in which a dcterms:Location occurs.
Comments	Recommended best practice is to use an ISO 3166-1-alpha-2 country code, or 'ZZ' (for an unknown location or a location unassignable to a single country code), or 'XZ' (for the high seas beyond national jurisdictions). Multiplicity and uncertainty of the geographic entity can be captured either in the term dwc:higherGeography or in the term dwc:locality, or both.
Examples	`AR` `SV` `XZ` `ZZ`
Type	string
Format	default

stateProvince

Title (Label)	State Province
Namespace	dwc
Table:	Event
IRI	http://rs.tdwg.org/dwc/terms/stateProvince
Description	A name of a next smaller administrative region than country (state, province, canton, department, region, etc.) in which a dcterms:Location occurs.
Comments	Recommended best practice is to use a controlled vocabulary such as the Getty Thesaurus of Geographic Names. Recommended best practice is to leave this field blank if a dcterms:Location spans multiple entities at this administrative level or if a dcterms:Location might be in one or another of multiple possible entities at this level. Multiplicity and uncertainty of the geographic entity can be captured either in the term dwc:higherGeography or in the term dwc:locality, or both.
Examples	`Montana` `Minas Gerais` `Córdoba`
Type	string
Format	default

county

Title (Label)	County
Namespace	dwc
Table:	Event
IRI	http://rs.tdwg.org/dwc/terms/county
Description	A full, unabbreviated name of a next smaller administrative region than dwc:stateProvince (county, shire, department, etc.) in which a dcterms:Location occurs.
Comments	Recommended best practice is to use a controlled vocabulary such as the Getty Thesaurus of Geographic Names. Recommended best practice is to leave this field blank if the dcterms:Location spans multiple entities at this administrative level or if the dcterms:Location might be in one or another of multiple possible entities at this level. Multiplicity and uncertainty of the geographic entity can be captured either in the term dwc:higherGeography or in the term dwc:locality, or both.
Examples	`Missoula` `Los Lagos` `Mataró`
Type	string
Format	default

municipality

Title (Label)	Municipality
Namespace	dwc
Table:	Event
IRI	http://rs.tdwg.org/dwc/terms/municipality
Description	A full, unabbreviated name of a next smaller administrative region than county (city, municipality, etc.) in which a dcterms:Location occurs. Do not use this term for a nearby named place that does not contain the actual location.
Comments	Recommended best practice is to use a controlled vocabulary such as the Getty Thesaurus of Geographic Names. Recommended best practice is to leave this field blank if a dcterms:Location spans multiple entities at this administrative level or if a dcterms:Location might be in one or another of multiple possible entities at this level. Multiplicity and uncertainty of the geographic entity can be captured either in the term `higherGeography` or in the term `locality`, or both.
Examples	`Holzminden` `Araçatuba` `Ga-Segonyana`
Type	string
Format	default

locality

Title (Label)	Locality
Namespace	dwc
Table:	Event
IRI	http://rs.tdwg.org/dwc/terms/locality
Description	A specific description of the location of a place.
Comments	Less specific geographic information can be provided in other geographic terms (higherGeography, continent, country, stateProvince, county, municipality, waterBody, island, islandGroup). This term may contain information modified from the original to correct perceived errors or standardize the description.
Examples	`Bariloche, 25 km NNE via Ruta Nacional 40 (=Ruta 237)` `Queets Rainforest, Olympic National Park`
Type	string
Format	default

minimumElevationInMeters

Title (Label)	Minimum Elevation In Meters
Namespace	dwc
Table:	Event
IRI	http://rs.tdwg.org/dwc/terms/minimumElevationInMeters
Description	A lower limit of a range of elevation (altitude, usually above sea level), in meters.
Examples	`-100` `802`
Type	number
Constraints	{'required': False, 'minimum': -430, 'maximum': 8850}
Format	default

maximumElevationInMeters

Title (Label)	Maximum Elevation In Meters
Namespace	dwc
Table:	Event
IRI	http://rs.tdwg.org/dwc/terms/maximumElevationInMeters
Description	An upper limit of a range of elevation (altitude, usually above sea level), in meters.
Examples	`-205` `1236`
Type	number
Constraints	{'required': False, 'minimum': -430, 'maximum': 8850}
Format	default

verticalDatum

Title (Label)	Vertical Datum
Namespace	dwc
Table:	Event
IRI	http://rs.tdwg.org/dwc/terms/verticalDatum
Description	A vertical datum used as a reference upon which the values in the elevation terms are based.
Comments	Recommended best practice is to use a controlled vocabulary.
Examples	`EGM84` `EGM96` `EGM2008` `PGM2000A` `PGM2004` `PGM2006` `PGM2007` `EPSG:7030` `not recorded`
Type	string
Format	default

minimumDepthInMeters

Title (Label)	Minimum Depth In Meters
Namespace	dwc
Table:	Event
IRI	http://rs.tdwg.org/dwc/terms/minimumDepthInMeters
Description	A lesser depth of a range of depth below the local surface, in meters.
Examples	`0` `100`
Type	number
Constraints	{'required': False, 'minimum': 0, 'maximum': 11000}
Format	default

maximumDepthInMeters

Title (Label)	Maximum Depth In Meters
Namespace	dwc
Table:	Event
IRI	http://rs.tdwg.org/dwc/terms/maximumDepthInMeters
Description	A greater depth of a range of depth below the local surface, in meters.
Examples	`0` `200`
Type	number
Constraints	{'required': False, 'minimum': 0, 'maximum': 11000}
Format	default

minimumDistanceAboveSurfaceInMeters

Title (Label)	Minimum Distance Above Surface In Meters
Namespace	dwc
Table:	Event
IRI	http://rs.tdwg.org/dwc/terms/minimumDistanceAboveSurfaceInMeters
Description	A lesser distance in a range of distance from a reference surface in the vertical direction, in meters. Use positive values for locations above the surface, negative values for locations below. If depth measures are given, the reference surface is the location given by the depth, otherwise the reference surface is the location given by the elevation.
Examples	`-1.5` (below the surface) `4.2` (above the surface) For a 1.5 meter sediment core from the bottom of a lake (at depth 20m) at 300m elevation: verbatimElevation: `300m` minimumElevationInMeters: `300`, maximumElevationInMeters: `300`, verbatimDepth: `20m`, minimumDepthInMeters: `20`, maximumDepthInMeters: `20`, minimumDistanceAboveSurfaceInMeters: `0`, maximumDistanceAboveSurfaceInMeters: `-1.5`.
Type	number
Format	default

maximumDistanceAboveSurfaceInMeters

Title (Label)	Maximum Distance Above Surface In Meters
Namespace	dwc
Table:	Event
IRI	http://rs.tdwg.org/dwc/terms/maximumDistanceAboveSurfaceInMeters
Description	A greater distance in a range of distance from a reference surface in the vertical direction, in meters. Use positive values for locations above the surface, negative values for locations below. If depth measures are given, the reference surface is the location given by the depth, otherwise the reference surface is the location given by the elevation.
Examples	`-1.5` (below the surface) `4.2` (above the surface) For a 1.5 meter sediment core from the bottom of a lake (at depth 20m) at 300m elevation: verbatimElevation: `300m` minimumElevationInMeters: `300`, maximumElevationInMeters: `300`, verbatimDepth: `20m`, minimumDepthInMeters: `20`, maximumDepthInMeters: `20`, minimumDistanceAboveSurfaceInMeters: `0`, maximumDistanceAboveSurfaceInMeters: `-1.5`.
Type	number
Format	default

locationRemarks

Title (Label)	Location Remarks
Namespace	dwc
Table:	Event
IRI	http://rs.tdwg.org/dwc/terms/locationRemarks
Description	Comments or notes about a dcterms:Location.
Examples	`under water since 2005`
Type	string
Format	default

decimalLatitude

Title (Label)	Decimal Latitude
Namespace	dwc
Table:	Event
IRI	http://rs.tdwg.org/dwc/terms/decimalLatitude
Description	A geographic latitude (in decimal degrees, using the spatial reference system given in dwc:geodeticDatum) of the geographic center of a dcterms:Location.
Comments	Positive values are north of the Equator, negative values are south of it. Legal values lie between -90 and 90, inclusive.
Examples	`-41.0983423`
Type	number
Constraints	{'required': False, 'minimum': -90, 'maximum': 90}
Format	default

decimalLongitude

Title (Label)	Decimal Longitude
Namespace	dwc
Table:	Event
IRI	http://rs.tdwg.org/dwc/terms/decimalLongitude
Description	A geographic longitude (in decimal degrees, using the spatial reference system given in dwc:geodeticDatum) of the geographic center of a dcterms:Location.
Comments	Positive values are east of the Greenwich Meridian, negative values are west of it. Legal values lie between -180 and 180, inclusive.
Examples	`-121.1761111`
Type	number
Constraints	{'required': False, 'minimum': -180, 'maximum': 180}
Format	default

geodeticDatum

Title (Label)	Geodetic Datum
Namespace	dwc
Table:	Event
IRI	http://rs.tdwg.org/dwc/terms/geodeticDatum
Description	An ellipsoid, geodetic datum, or spatial reference system (SRS) upon which the geographic coordinates given in dwc:decimalLatitude and dwc:decimalLongitude as based.
Comments	Recommended best practice is to use the EPSG code of the SRS, if known. Otherwise use a controlled vocabulary for the name or code of the geodetic datum, if known. Otherwise use a controlled vocabulary for the name or code of the ellipsoid, if known. If none of these is known, use the value `not recorded`.
Examples	`EPSG:4326` `WGS84` `NAD27` `Campo Inchauspe` `European 1950` `Clarke 1866` `not recorded`
Type	string
Format	default

coordinateUncertaintyInMeters

Title (Label)	Coordinate Uncertainty In Meters
Namespace	dwc
Table:	Event
IRI	http://rs.tdwg.org/dwc/terms/coordinateUncertaintyInMeters
Description	A horizontal distance (in meters) from a given dwc:decimalLatitude and dwc:decimalLongitude describing the smallest circle containing the whole of the dcterms:Location.
Comments	Leave the value empty if the uncertainty is unknown, cannot be estimated, or is not applicable (because there are no coordinates). Zero is not a valid value for this term.
Examples	`30` (reasonable lower limit on or after 2000-05-01 of a GPS reading under good conditions if the actual precision was not recorded at the time) `100` (reasonable lower limit before 2000-05-01 of a GPS reading under good conditions if the actual precision was not recorded at the time) `71` (uncertainty for a UTM coordinate having 100 meter precision and a known spatial reference system)
Type	number
Constraints	{'required': False, 'minimum': 1, 'maximum': 20037509}
Format	default

coordinatePrecision

Title (Label)	Coordinate Precision
Namespace	dwc
Table:	Event
IRI	http://rs.tdwg.org/dwc/terms/coordinatePrecision
Description	A decimal representation of the precision of the coordinates given in a dwc:decimalLatitude and dwc:decimalLongitude.
Examples	`0.00001` (normal GPS limit for decimal degrees) `0.000278` (nearest second) `0.01667` (nearest minute) `1.0` (nearest degree)
Type	number
Format	default

pointRadiusSpatialFit

Title (Label)	Point Radius Spatial Fit
Namespace	dwc
Table:	Event
IRI	http://rs.tdwg.org/dwc/terms/pointRadiusSpatialFit
Description	A ratio of the area of a point-radius (dwc:decimalLatitude, dwc:decimalLongitude, dwc:coordinateUncertaintyInMeters) to the area of a true (original, or most specific) spatial representation of a dcterms:Location.
Comments	Legal values are 0, greater than or equal to 1, or undefined. A value of 1 is an exact match or 100% overlap. A value of 0 should be used if the given point-radius does not completely contain the original representation. The pointRadiusSpatialFit is undefined (and should be left empty) if the original representation is any geometry without area (e.g., a point or polyline) and without uncertainty and the given georeference is not that same geometry (without uncertainty). If both the original and the given georeference are the same point, the pointRadiusSpatialFit is 1. Detailed explanations with graphical examples can be found in the Georeferencing Best Practices, Chapman and Wieczorek, 2020 (https://doi.org/10.15468/doc-gg7h-s853).
Examples	`0` `1` `1.5708`
Type	number
Constraints	{'required': False, 'minimum': 0}
Format	default

footprintWKT

Title (Label)	Footprint WKT
Namespace	dwc
Table:	Event
IRI	http://rs.tdwg.org/dwc/terms/footprintWKT
Description	A Well-Known Text (WKT) representation of the shape (footprint, geometry) that defines a dcterms:Location.
Comments	A dcterms:Location may have both a point-radius representation (see dwc:decimalLatitude) and a footprint representation, and they may differ from each other.
Examples	`POLYGON ((10 20, 11 20, 11 21, 10 21, 10 20))` (the one-degree bounding box with opposite corners at longitude=10, latitude=20 and longitude=11, latitude=21)
Type	string
Format	default

footprintSRS

Title (Label)	Footprint SRS
Namespace	dwc
Table:	Event
IRI	http://rs.tdwg.org/dwc/terms/footprintSRS
Description	An ellipsoid, geodetic datum, or spatial reference system (SRS) upon which a geometry given in dwc:footprintWKT is based.
Comments	Recommended best practice is to use the EPSG code of the SRS, if known. Otherwise use a controlled vocabulary for the name or code of the geodetic datum, if known. Otherwise use a controlled vocabulary for the name or code of the ellipsoid, if known. If none of these is known, use the value `not recorded`. It is also permitted to provide the SRS in Well-Known-Text, especially if no EPSG code provides the necessary values for the attributes of the SRS. Do not use this term to describe the SRS of a dwc:decimalLatitude and dwc:decimalLongitude, nor of any verbatim coordinates - use dwc:geodeticDatum and dwc:verbatimSRS instead.
Examples	`EPSG:4326` `GEOGCS['GCS_WGS_1984', DATUM['D_WGS_1984', SPHEROID['WGS_1984',6378137,298.257223563]], PRIMEM['Greenwich',0], UNIT['Degree',0.0174532925199433]]` (WKT for the standard WGS84 Spatial Reference System EPSG:4326)
Type	string
Format	default

footprintSpatialFit

Title (Label)	Footprint Spatial Fit
Namespace	dwc
Table:	Event
IRI	http://rs.tdwg.org/dwc/terms/footprintSpatialFit
Description	A ratio of the area of a footprint (dwc:footprintWKT) to the area of a true (original, or most specific) spatial representation of a dcterms:Location.
Comments	Legal values are 0, greater than or equal to 1, or undefined. A value of 1 is an exact match or 100% overlap. A value of 0 should be used if the given footprint does not completely contain the original representation. A dwc:footprintSpatialFit is undefined (and should be left empty) if the original representation is any geometry without area (e.g., a point or polyline) and without uncertainty and the given georeference is not that same geometry (without uncertainty). If both the original and the given georeference are the same point, a dwc:footprintSpatialFit is 1.
Examples	`0` `1` `1.5708`
Type	number
Format	default

georeferencedBy

Title (Label)	Georeferenced By
Namespace	dwc
Table:	Event
IRI	http://rs.tdwg.org/dwc/terms/georeferencedBy
Description	A list (concatenated and separated) of names of Agents responsible for determining a georeference (spatial representation) for a dcterms:Location.
Comments	Recommended best practice is to separate the values in a list with space vertical bar space (` \| `).
Examples	`Brad Millen (ROM)` `Kristina Yamamoto \| Janet Fang`
Type	string
Format	default

georeferencedByID

Title (Label)	Georeferenced By ID
Namespace	dwcdp
Table:	Event
Description	An identifier for the Agent responsible for determining a georeference for a dwc:Event.
Comments	Recommended best practice is to use a globally unique identifier.
Examples	`https://orcid.org/0000-0002-1825-0097`
Type	string
Format	default

georeferencedDate

Title (Label)	Georeferenced Date
Namespace	dwc
Table:	Event
IRI	http://rs.tdwg.org/dwc/terms/georeferencedDate
Description	A date on which a dcterms:Location was georeferenced.
Comments	Recommended best practice is to use a date that conforms to ISO 8601-1:2019.
Examples	`2023-05-04`
Type	string
Format	default

georeferenceProtocol

Title (Label)	Georeference Protocol
Namespace	dwc
Table:	Event
IRI	http://rs.tdwg.org/dwc/terms/georeferenceProtocol
Description	A description or reference to a Protocol used to determine the spatial footprint, coordinates, and uncertainties.
Examples	`Georeferencing Quick Reference Guide (Zermoglio et al. 2020, https://doi.org/10.35035/e09p-h128)`
Type	string
Format	default

georeferenceProtocolID

Title (Label)	Georeference Protocol ID
Namespace	dwciri
Table:	Event
IRI	http://rs.tdwg.org/dwc/iri/georeferenceProtocol
Description	An identifier for a Protocol used to georeference a dwc:Event.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Format	default

georeferenceSources

Title (Label)	Georeference Sources
Namespace	dwc
Table:	Event
IRI	http://rs.tdwg.org/dwc/terms/georeferenceSources
Description	A list (concatenated and separated) of maps, gazetteers, or other resources used to georeference a dcterms:Location, described specifically enough to allow anyone in the future to use the same resources.
Comments	Recommended best practice is to separate the values in a list with space vertical bar space (` \| `).
Examples	`https://www.geonames.org/` `USGS 1:24000 Florence Montana Quad 1967 \| Terrametrics 2008 on Google Earth` `GeoLocate`
Type	string
Format	default

georeferenceRemarks

Title (Label)	Georeference Remarks
Namespace	dwc
Table:	Event
IRI	http://rs.tdwg.org/dwc/terms/georeferenceRemarks
Description	Comments or notes about a spatial description determination, explaining assumptions made in addition or opposition to the those formalized in the method referred to in dwc:georeferenceProtocol.
Examples	`Assumed distance by road (Hwy. 101)`
Type	string
Format	default

informationWithheld

Title (Label)	Information Withheld
Namespace	dwc
Table:	Event
IRI	http://rs.tdwg.org/dwc/terms/informationWithheld
Description	Additional information that exists, but that has not been shared in the given record.
Examples	`location information not given for endangered species` `collector identities withheld \| ask about tissue samples`
Type	string
Format	default

dataGeneralizations

Title (Label)	Data Generalizations
Namespace	dwc
Table:	Event
IRI	http://rs.tdwg.org/dwc/terms/dataGeneralizations
Description	Actions taken to make the shared data less specific or complete than in its original form. Suggests that alternative data of higher quality may be available on request.
Examples	`coordinates generalized from original GPS coordinates to the nearest half degree grid cell`
Type	string
Format	default

preferredSpatialRepresentation

Title (Label)	Preferred Spatial Representation
Namespace	dwcdp
Table:	Event
Description	An indication of which spatial representation best represents the dcterms:Location.
Examples	`point-radius` `footprint`
Type	string
Format	default

projectID

Title (Label)	Project ID
Namespace	dwc
Table:	Event
IRI	http://rs.tdwg.org/dwc/terms/projectID
Description	A list (concatenated and separated) of identifiers for projects that contributed to a dwc:Event.
Comments	A projectID can be may be shared in multiple distinct datasets. The nature of the association can be described in the metadata project description element. This term should be used to provide a globally unique identifier (GUID) for a project, if available. This could be a DOI, URI, or any other persistent identifier that ensures a project can be uniquely distinguished from others. The recommended best practice is to separate the values in a list with space vertical bar space ( \| ).
Examples	`RCN276730` `RCN276730 \| Artsproject_7-24` `OC202405` `https://arvenetternansen.com/` `https://doi.org/10.3030/101180559` `https://doi.org/10.26259/3b15eca7`
Type	string
Format	default

projectTitle

Title (Label)	Project Title
Namespace	dwc
Table:	Event
IRI	http://rs.tdwg.org/dwc/terms/projectTitle
Description	A list (concatenated and separated) of titles or names for projects that contributed to a dwc:Event.
Comments	Use this term to provide the official name or title of a project as it is commonly known and cited. Avoid abbreviations unless they are widely understood. The recommended best practice is to separate the values in a list with space vertical bar space ( \| ).
Examples	`The Nansen Legacy` `Scalidophora i Noreg` `Arctic Deep`
Type	string
Format	default

fundingAttribution

Title (Label)	Funding Attribution
Namespace	ac
Table:	Event
IRI	http://rs.tdwg.org/ac/terms/fundingAttribution
Description	A list (concatenated and separated) of names of the funding organizations or agencies that provided funding for the project.
Comments	Specify the full official name of the funding body. This should include the complete name without abbreviations, unless the abbreviation is an official and commonly recognized form (e.g., NSF for the National Science Foundation). The recommended best practice is to separate the values in a list with space vertical bar space ( \| ).
Examples	`Norges forskningsråd` `Artsdatabanken` `Ocean Census \| Nippon Foundation`
Type	string
Format	default

fundingAttributionID

Title (Label)	Funding Attribution ID
Namespace	dwc
Table:	Event
IRI	http://rs.tdwg.org/dwc/terms/fundingAttributionID
Description	A list (concatenated and separated) of the globally unique identifiers for the funding organizations or agencies that supported the project.
Comments	Provide a unique identifier for the funding body, such as an identifier used in governmental or international databases. If no official identifier exists, use a persistent and unique identifier within your organization or dataset. The recommended best practice is to separate the values in a list with space vertical bar space ( \| ).
Examples	`https://ror.org/00epmv149` `https://ror.org/00epmv149 \| https://ror.org/04jnzhb65` `https://www.wikidata.org/wiki/Q13102615`
Type	string
Format	default

feedbackURL

Title (Label)	Feedback URL
Namespace	dwc
Table:	Event
IRI	http://rs.tdwg.org/dwc/terms/feedbackURL
Comments	A uniform resource locator (URL) that points to a webpage on which a form may be submitted to gather feedback about the record.
Type	string
Format	default

ChronometricAge

Identifier: http://rs.tdwg.org/dwc/dwc-dp/chronometric-age

Description: An approximation of temporal position (in the sense conveyed by https://www.w3.org/TR/owl-time/#time:TemporalPosition) that is supported by evidence.

Comments: The age of a specimen and how this age is known, whether by a dating assay, a relative association with dated material, or legacy collections information.

Examples:

`an age range associated with a specimen derived from an AMS dating assay applied to an oyster shell in the same stratum`

`an age range associated with a specimen derived from a ceramics analysis based on other materials found in the same stratum`

`a maximum age associated with a specimen derived from K-Ar dating applied to a proximal volcanic tuff found stratigraphically below the specimen`

`an age range of a specimen based on its biostratigraphic context`

`an age of a specimen based on what is reported in legacy collections data`

Relationships to Other Tables

Field	Target Table	Target Field	Required
eventID	event	eventID	Yes
chronometricAgeProtocolID	protocol	protocolID	No
chronometricAgeConversionProtocolID	protocol	protocolID	No
materialDatedID	material	materialEntityID	No
chronometricAgeDeterminedByID	agent	agentID	No

chronometricAgeID

Title (Label)	Chronometric Age ID
Namespace	chrono
Table:	ChronometricAge
IRI	http://rs.tdwg.org/chrono/terms/chronometricAgeID
Description	An identifier for a chrono:ChronometricAge.
Comments	Recommended best practice is to use a globally unique identifier.
Examples	`https://www.canadianarchaeology.ca/samples/70673`
Type	string
Constraints	{'required': True, 'unique': True}
Format	default

eventID

Title (Label)	Event ID
Namespace	dwc
Table:	ChronometricAge
IRI	http://rs.tdwg.org/dwc/terms/eventID
Description	An identifier for a dwc:Event.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

verbatimChronometricAge

Title (Label)	Verbatim Chronometric Age
Namespace	chrono
Table:	ChronometricAge
IRI	http://rs.tdwg.org/chrono/terms/verbatimChronometricAge
Description	A verbatim age for a dwc:Event, whether reported by a dating assay, associated references, or legacy information.
Comments	For example, this could be the radiocarbon age as given in an AMS dating report. This could also be simply what is reported as the age of a specimen in legacy collections data.
Examples	`27 BC to 14 AD` `stratigraphically pre-1104`
Type	string
Format	default

chronometricAgeProtocol

Title (Label)	Chronometric Age Protocol
Namespace	chrono
Table:	ChronometricAge
IRI	http://rs.tdwg.org/chrono/terms/chronometricAgeProtocol
Description	A description of or reference to a Protocol used to determine a chrono:ChronometricAge.
Examples	`radiocarbon AMS` `K-Ar dates for the lower most marker tuff` `historic documentation` `ceramic seriation`
Type	string
Format	default

chronometricAgeProtocolID

Title (Label)	Chronometric Age Protocol ID
Namespace	dwcdp
Table:	ChronometricAge
Description	An identifier for a Protocol used to determine a chrono:ChronometricAge.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Format	default

uncalibratedChronometricAge

Title (Label)	Uncalibrated Chronometric Age
Namespace	chrono
Table:	ChronometricAge
IRI	http://rs.tdwg.org/chrono/terms/uncalibratedChronometricAge
Description	An output of a dating assay before it is calibrated into an age using a specific conversion protocol.
Examples	`1510 +/- 25 14C yr BP` `16.26 Ma +/- 0.016`
Type	string
Format	default

chronometricAgeConversionProtocol

Title (Label)	Chronometric Age Conversion Protocol
Namespace	chrono
Table:	ChronometricAge
IRI	http://rs.tdwg.org/chrono/terms/chronometricAgeConversionProtocol
Description	A description of or reference to a Protocol used to convert a chrono:uncalibratedChronometricAge into a chronometric age in years, as captured in the chrono:earliestChronometricAge, chrono:earliestChronometricAgeReferenceSystem, chrono:latestChronometricAge, and chrono:latestChronometricAgeReferenceSystem fields.
Comments	For example, calibration of conventional radiocarbon age or the currently accepted age range of a cultural or geological period.
Examples	`INTCAL13` `sequential 6 phase Bayesian model and IntCal13 calibration`
Type	string
Format	default

chronometricAgeConversionProtocolID

Title (Label)	Chronometric Age Conversion Protocol ID
Namespace	dwcdp
Table:	ChronometricAge
Description	An identifier for a Protocol used to convert a chrono:uncalibratedChronometricAge into a chronometric age in years, as captured in the chrono:earliestChronometricAge, chrono:earliestChronometricAgeReferenceSystem, chrono:latestChronometricAge, and chrono:latestChronometricAgeReferenceSystem fields.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Format	default

earliestChronometricAge

Title (Label)	Earliest Chronometric Age
Namespace	chrono
Table:	ChronometricAge
IRI	http://rs.tdwg.org/chrono/terms/earliestChronometricAge
Description	A maximum/earliest/oldest possible age of a dwc:MaterialEntity as determined by a dating method.
Comments	The expected unit for this field is years. This field, if populated, must have an associated chrono:earliestChronometricAgeReferenceSystem.
Examples	`100`
Type	string
Format	default

earliestChronometricAgeReferenceSystem

Title (Label)	Earliest Chronometric Age Reference System
Namespace	chrono
Table:	ChronometricAge
IRI	http://rs.tdwg.org/chrono/terms/earliestChronometricAgeReferenceSystem
Description	A reference system associated with a chrono:earliestChronometricAge.
Comments	Recommended best practice is to use a controlled vocabulary.
Examples	`kya` `mya` `BP` `AD` `BCE` `ka` `Ma` `Ga`
Type	string
Format	default

latestChronometricAge

Title (Label)	Latest Chronometric Age
Namespace	chrono
Table:	ChronometricAge
IRI	http://rs.tdwg.org/chrono/terms/latestChronometricAge
Description	A minimum/latest/youngest possible age of a dwc:MaterialEntity as determined by a dating method.
Comments	The expected unit for this field is years. This field, if populated, must have an associated latestChronometricAgeReferenceSystem.
Examples	`27`
Type	string
Format	default

latestChronometricAgeReferenceSystem

Title (Label)	Latest Chronometric Age Reference System
Namespace	chrono
Table:	ChronometricAge
IRI	http://rs.tdwg.org/chrono/terms/latestChronometricAgeReferenceSystem
Description	A reference system associated with a chrono:latestChronometricAge.
Comments	Recommended best practice is to use a controlled vocabulary.
Examples	`kya` `mya` `BP` `AD` `BCE` `ka` `Ma` `Ga`
Type	string
Format	default

chronometricAgeUncertaintyInYears

Title (Label)	Chronometric Age Uncertainty In Years
Namespace	chrono
Table:	ChronometricAge
IRI	http://rs.tdwg.org/chrono/terms/chronometricAgeUncertaintyInYears
Description	A temporal uncertainty of a chrono:earliestChronometricAge and chrono:latestChronometicAge in years.
Comments	The expected unit for this field is years. The value in this field is number of years before and after the values given in the earliest and latest chronometric age fields within which the actual values are estimated to be.
Examples	`100`
Type	integer
Format	default

chronometricAgeUncertaintyMethod

Title (Label)	Chronometric Age Uncertainty Method
Namespace	chrono
Table:	ChronometricAge
IRI	http://rs.tdwg.org/chrono/terms/chronometricAgeUncertaintyMethod
Description	A method used to generate a value of chrono:ChronometricAgeUncertaintyInYears.
Examples	`2-sigma calibrated range` `Half of 95% confidence interval`
Type	string
Format	default

materialDated

Title (Label)	Material Dated
Namespace	chrono
Table:	ChronometricAge
IRI	http://rs.tdwg.org/chrono/terms/materialDated
Description	A description of a dwc:MaterialEntity on which a chrono:ChronometricAgeProtocol was actually performed, if known.
Comments	Recommended best practice is to use a globally unique identifier.
Examples	`Double Tuff` `Charcoal found in Stratum V` `charred wood` `tooth`
Type	string
Format	default

materialDatedID

Title (Label)	Material Dated ID
Namespace	chrono
Table:	ChronometricAge
IRI	http://rs.tdwg.org/chrono/terms/materialDatedID
Description	An identifier for a dwc:MaterialEntity on which a chrono:ChronometricAgeProtocol was performed, if applicable.
Comments	Recommended best practice is to use a globally unique identifier.
Examples	`https://www.ebi.ac.uk/metagenomics/samples/SRS1930158`
Type	string
Format	default

materialDatedRelationship

Title (Label)	Material Dated Relationship
Namespace	chrono
Table:	ChronometricAge
IRI	http://rs.tdwg.org/chrono/terms/materialDatedRelationship
Description	A relationship of a chrono:materialDated to a dwc:MaterialEntity, from which a chrono:ChronometricAge of the related dwc:MaterialEntity and any related dwc:Occurrence is inferred.
Comments	Recommended best practice is to use a controlled vocabulary.
Examples	`sameAs` (cases where the subject material was completely destructively subsampled to get the chrono:ChronometricAge) `subsampleOf` (cases where part of the original dwc:MaterialEntity was extracted as the material used to determine the chrono:ChronometricAge) `inContextWith` (cases where the chrono:ChronometricAge is inferred from materialDated, such as sediments or cultural objects, in related temporal context) `stratigraphicallyCorrelatedWith` (cases where the chrono:ChronometricAge is inferred from materialDated in a stratigraphically correlated context)
Type	string
Format	default

chronometricAgeDeterminedBy

Title (Label)	Chronometric Age Determined By
Namespace	chrono
Table:	ChronometricAge
IRI	http://rs.tdwg.org/chrono/terms/chronometricAgeDeterminedBy
Description	A list (concatenated and separated) of names of Agents responsible for determining the chrono:ChronometricAge.
Comments	Recommended best practice is to separate the values in a list with space vertical bar space ( \| ).
Examples	`Michelle LeFebvre \| Neill Wallis`
Type	string
Format	default

chronometricAgeDeterminedByID

Title (Label)	Chronometric Age Determined By ID
Namespace	dwcdp
Table:	ChronometricAge
Description	An identifier for an Agent responsible for determining a chrono:ChronometricAge.
Comments	Recommended best practice is to provide a single identifier that disambiguates the details of the acting agent. If a list is used, the order of the agents on the list should not be assumed to convey any semantics. Recommended best practice is to separate the values in a list with space vertical bar space (` \| `).
Examples	`https://orcid.org/0000-0002-1825-0097`
Type	string
Format	default

chronometricAgeDeterminedDate

Title (Label)	Chronometric Age Determined Date
Namespace	chrono
Table:	ChronometricAge
IRI	http://rs.tdwg.org/chrono/terms/chronometricAgeDeterminedDate
Description	A date on which a chrono:ChronometricAge was determined.
Comments	Recommended best practice is to use a date that conforms to ISO 8601-1:2019.
Examples	`1963-03-08T14:07-06:00` (8 Mar 1963 at 2:07pm in the time zone six hours earlier than UTC) `2009-02-20T08:40Z` (20 February 2009 8:40am UTC) `2018-08-29T15:19` (3:19pm local time on 29 August 2018) `1809-02-12` (some time during 12 February 1809) `1906-06` (some time in June 1906) `1971` (some time in the year 1971).
Type	string
Format	default

chronometricAgeReferences

Title (Label)	Chronometric Age References
Namespace	chrono
Table:	ChronometricAge
IRI	http://rs.tdwg.org/chrono/terms/chronometricAgeReferences
Description	A list (concatenated and separated) of identifiers (publication, bibliographic reference, global unique identifier, URI) of literature associated with the chrono:ChronometricAge.
Comments	Recommended best practice is to separate the values in a list with space vertical bar space ( \| ).
Examples	`Pluckhahn, Thomas J., Neill J. Wallis, and Victor D. Thompson. 2020 The History and Future of Migrationist Explanation in the Archaeology of the Eastern Woodlands: A Review and Case Study of the Woodland Period Gulf Coast. Journal of Archaeological Research. https://doi.org/10.1007/s10814-019-09140-x`
Type	string
Format	default

chronometricAgeRemarks

Title (Label)	Chronometric Age Remarks
Namespace	chrono
Table:	ChronometricAge
IRI	http://rs.tdwg.org/chrono/terms/chronometricAgeRemarks
Description	Comments or notes about a chrono:ChronometricAge.
Examples	`Beta Analytic number: 323913 \| One of the Crassostrea virginica right valve specimens from North Midden Feature 17 was chosen for AMS dating, but it is unclear exactly which specimen it was.`
Type	string
Format	default

GeologicalContext

Identifier: http://rs.tdwg.org/dwc/dwc-dp/geological-context

Description: A set of geological designations, such as stratigraphy, that qualifies a region or place.

Examples:

`a particular lithostratigraphic layer`

`a specific chronostratigraphic unit`

Relationships to Other Tables

Field	Target Table	Target Field	Required
eventID	event	eventID	Yes

geologicalContextID

Title (Label)	Geological Context ID
Namespace	dwc
Table:	GeologicalContext
IRI	http://rs.tdwg.org/dwc/terms/geologicalContextID
Description	An identifier for a dwc:GeologicalContext.
Comments	Recommended best practice is to use a globally unique identifier.
Examples	`https://opencontext.org/subjects/e54377f7-4452-4315-b676-40679b10c4d9`
Type	string
Constraints	{'required': True, 'unique': True}
Format	default

eventID

Title (Label)	Event ID
Namespace	dwcdp
Table:	GeologicalContext
IRI	http://rs.tdwg.org/dwc/terms/eventID
Description	An identifier for a dwc:Event.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

earliestEonOrLowestEonothem

Title (Label)	Earliest Eon Or Lowest Eonothem
Namespace	dwc
Table:	GeologicalContext
IRI	http://rs.tdwg.org/dwc/terms/earliestEonOrLowestEonothem
Description	A full name of a earliest possible geochronologic eon or lowest chrono-stratigraphic eonothem or the informal name ('Precambrian') attributable to the stratigraphic horizon from which a dwc:MaterialEntity was collected.
Examples	`Phanerozoic` `Proterozoic`
Type	string
Format	default

latestEonOrHighestEonothem

Title (Label)	Latest Eon Or Highest Eonothem
Namespace	dwc
Table:	GeologicalContext
IRI	http://rs.tdwg.org/dwc/terms/latestEonOrHighestEonothem
Description	A full name of a latest possible geochronologic eon or highest chrono-stratigraphic eonothem or the informal name ('Precambrian') attributable to the stratigraphic horizon from which a dwc:MaterialEntity was collected.
Examples	`Phanerozoic` `Proterozoic`
Type	string
Format	default

earliestEraOrLowestErathem

Title (Label)	Earliest Era Or Lowest Erathem
Namespace	dwc
Table:	GeologicalContext
IRI	http://rs.tdwg.org/dwc/terms/earliestEraOrLowestErathem
Description	A full name of a earliest possible geochronologic era or lowest chronostratigraphic erathem attributable to the stratigraphic horizon from which a dwc:MaterialEntity was collected.
Examples	`Cenozoic` `Mesozoic`
Type	string
Format	default

latestEraOrHighestErathem

Title (Label)	Latest Era Or Highest Erathem
Namespace	dwc
Table:	GeologicalContext
IRI	http://rs.tdwg.org/dwc/terms/latestEraOrHighestErathem
Description	A full name of a latest possible geochronologic era or highest chronostratigraphic erathem attributable to the stratigraphic horizon from which a dwc:MaterialEntity was collected.
Examples	`Cenozoic` `Mesozoic`
Type	string
Format	default

earliestPeriodOrLowestSystem

Title (Label)	Earliest Period Or Lowest System
Namespace	dwc
Table:	GeologicalContext
IRI	http://rs.tdwg.org/dwc/terms/earliestPeriodOrLowestSystem
Description	A full name of a earliest possible geochronologic period or lowest chronostratigraphic system attributable to the stratigraphic horizon from which a dwc:MaterialEntity was collected.
Examples	`Neogene` `Tertiary` `Quaternary`
Type	string
Format	default

latestPeriodOrHighestSystem

Title (Label)	Latest Period Or Highest System
Namespace	dwc
Table:	GeologicalContext
IRI	http://rs.tdwg.org/dwc/terms/latestPeriodOrHighestSystem
Description	A full name of a latest possible geochronologic period or highest chronostratigraphic system attributable to the stratigraphic horizon from which a dwc:MaterialEntity was collected.
Examples	`Neogene` `Tertiary` `Quaternary`
Type	string
Format	default

earliestEpochOrLowestSeries

Title (Label)	Earliest Epoch Or Lowest Series
Namespace	dwc
Table:	GeologicalContext
IRI	http://rs.tdwg.org/dwc/terms/earliestEpochOrLowestSeries
Description	A full name of a earliest possible geochronologic epoch or lowest chronostratigraphic series attributable to the stratigraphic horizon from which a dwc:MaterialEntity was collected.
Examples	`Holocene` `Pleistocene` `Ibexian Series`
Type	string
Format	default

latestEpochOrHighestSeries

Title (Label)	Latest Epoch Or Highest Series
Namespace	dwc
Table:	GeologicalContext
IRI	http://rs.tdwg.org/dwc/terms/latestEpochOrHighestSeries
Description	A full name of a latest possible geochronologic epoch or highest chronostratigraphic series attributable to the stratigraphic horizon from which a dwc:MaterialEntity was collected.
Examples	`Holocene` `Pleistocene` `Ibexian Series`
Type	string
Format	default

earliestAgeOrLowestStage

Title (Label)	Earliest Age Or Lowest Stage
Namespace	dwc
Table:	GeologicalContext
IRI	http://rs.tdwg.org/dwc/terms/earliestAgeOrLowestStage
Description	A full name of a earliest possible geochronologic age or lowest chronostratigraphic stage attributable to the stratigraphic horizon from which a dwc:MaterialEntity was collected.
Examples	`Atlantic` `Boreal` `Skullrockian`
Type	string
Format	default

latestAgeOrHighestStage

Title (Label)	Latest Age Or Highest Stage
Namespace	dwc
Table:	GeologicalContext
IRI	http://rs.tdwg.org/dwc/terms/latestAgeOrHighestStage
Description	A full name of a latest possible geochronologic age or highest chronostratigraphic stage attributable to the stratigraphic horizon from which a dwc:MaterialEntity was collected.
Examples	`Atlantic` `Boreal` `Skullrockian`
Type	string
Format	default

lowestBiostratigraphicZone

Title (Label)	Lowest Biostratigraphic Zone
Namespace	dwc
Table:	GeologicalContext
IRI	http://rs.tdwg.org/dwc/terms/lowestBiostratigraphicZone
Description	A full name of a lowest possible geological biostratigraphic zone of the stratigraphic horizon from which a dwc:MaterialEntity was collected.
Examples	`Maastrichtian`
Type	string
Format	default

highestBiostratigraphicZone

Title (Label)	Highest Biostratigraphic Zone
Namespace	dwc
Table:	GeologicalContext
IRI	http://rs.tdwg.org/dwc/terms/highestBiostratigraphicZone
Description	A full name of a highest possible geological biostratigraphic zone of the stratigraphic horizon from which a dwc:MaterialEntity was collected.
Examples	`Blancan`
Type	string
Format	default

lithostratigraphicTerms

Title (Label)	Lithostratigraphic Terms
Namespace	dwc
Table:	GeologicalContext
IRI	http://rs.tdwg.org/dwc/terms/lithostratigraphicTerms
Description	A combination of all lithostratigraphic names for a rock from which a dwc:MaterialEntity was collected.
Examples	`Pleistocene-Weichselien`
Type	string
Format	default

group

Title (Label)	Group
Namespace	dwc
Table:	GeologicalContext
IRI	http://rs.tdwg.org/dwc/terms/group
Description	A full name of a lithostratigraphic group from which a dwc:MaterialEntity was collected.
Examples	`Bathurst` `Lower Wealden`
Type	string
Format	default

formation

Title (Label)	Formation
Namespace	dwc
Table:	GeologicalContext
IRI	http://rs.tdwg.org/dwc/terms/formation
Description	A full name of a lithostratigraphic formation from which a dwc:MaterialEntity was collected.
Examples	`Notch Peak Formation` `House Limestone` `Fillmore Formation`
Type	string
Format	default

member

Title (Label)	Member
Namespace	dwc
Table:	GeologicalContext
IRI	http://rs.tdwg.org/dwc/terms/member
Description	A full name of a lithostratigraphic member from which a dwc:MaterialEntity was collected.
Examples	`Lava Dam Member` `Hellnmaria Member`
Type	string
Format	default

bed

Title (Label)	Bed
Namespace	dwc
Table:	GeologicalContext
IRI	http://rs.tdwg.org/dwc/terms/bed
Description	A full name of a lithostratigraphic bed from which a dwc:MaterialEntity was collected.
Examples	`Harlem coal`
Type	string
Format	default

Occurrence

Identifier: http://rs.tdwg.org/dwc/dwc-dp/occurrence

Description: A state of a dwc:Organism in a dwc:Event.

Examples:

`a wolf pack on the shore of Kluane Lake in 1988`

`a virus in a plant leaf in the New York Botanical Garden at 15:29 on 2014-10-23`

`a fungus in Central Park in the summer of 1929`

Relationships to Other Tables

Field	Target Table	Target Field	Required
eventID	event	eventID	Yes
surveyTargetID	survey-target	surveyTargetID	No
recordedByID	agent	agentID	No
identifiedByID	agent	agentID	No

occurrenceID

Title (Label)	Occurrence ID
Namespace	dwc
Table:	Occurrence
IRI	http://rs.tdwg.org/dwc/terms/occurrenceID
Description	An identifier for a dwc:Occurrence.
Comments	Recommended best practice is to use a persistent, globally unique identifier. In the absence of a persistent global unique identifier, construct one from a combination of identifiers in the record that will most closely make a dwc:occurrenceID globally unique.
Examples	`http://arctos.database.museum/guid/MSB:Mamm:233627`
Type	string
Constraints	{'required': True, 'unique': True}
Format	default

eventID

Title (Label)	Event ID
Namespace	dwcdp
Table:	Occurrence
IRI	http://rs.tdwg.org/dwc/terms/eventID
Description	An identifier for a dwc:Event.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

surveyTargetID

Title (Label)	Survey Target ID
Namespace	dwcdp
Table:	Occurrence
Description	An identifier for a SurveyTarget.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Format	default

recordedBy

Title (Label)	Recorded By
Namespace	dwc
Table:	Occurrence
IRI	http://rs.tdwg.org/dwc/terms/recordedBy
Description	A list (concatenated and separated) of names of Agents responsible for recording a dwc:Occurrence.
Comments	Recommended best practice is to separate the values in a list with space vertical bar space ( \| ).
Examples	`José E. Crespo` `Oliver P. Pearson \| Anita K. Pearson` `FMNH`
Type	string
Format	default

recordedByID

Title (Label)	Recorded By ID
Namespace	dwc
Table:	Occurrence
IRI	http://rs.tdwg.org/dwc/terms/recordedByID
Description	An identifier for the Agent responsible for recording a dwc:Occurrence.
Comments	Recommended best practice is to use a globally unique identifier.
Examples	`https://orcid.org/0000-0002-1825-0097` `https://ror.org/00mh9zx15`
Type	string
Format	default

organismQuantity

Title (Label)	Organism Quantity
Namespace	dwc
Table:	Occurrence
IRI	http://rs.tdwg.org/dwc/terms/organismQuantity
Description	A number or enumeration value for the quantity of dwc:Organisms.
Comments	A dwc:organismQuantity must have a corresponding dwc:organismQuantityType.
Examples	`27` (organismQuantity) with `individuals` (organismQuantityType) `12.5` (organismQuantity) with `% biomass` (organismQuantityType) `r` (organismQuantity) with `Braun-Blanquet Scale` (organismQuantityType) `many` (organismQuantity) with `individuals` (organismQuantityType)
Type	string
Format	default

organismQuantityType

Title (Label)	Organism Quantity Type
Namespace	dwc
Table:	Occurrence
IRI	http://rs.tdwg.org/dwc/terms/organismQuantity
Description	A type of quantification system used for the quantity of dwc:Organisms.
Comments	A dwc:organismQuantityType must have a corresponding dwc:organismQuantity. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`27` (organismQuantity) with `individuals` (organismQuantityType) `12.5` (organismQuantity) with `% biomass` (organismQuantityType) `r` (organismQuantity) with `Braun-Blanquet Scale` (organismQuantityType) `many` (organismQuantity) with `individuals` (organismQuantityType)
Type	string
Format	default

sex

Title (Label)	Sex
Namespace	dwc
Table:	Occurrence
IRI	http://rs.tdwg.org/dwc/terms/sex
Description	A sex of a dwc:Organism.
Comments	Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`male` `female` `hermaphrodite`
Type	string
Format	default

lifeStage

Title (Label)	Life Stage
Namespace	dwc
Table:	Occurrence
IRI	http://rs.tdwg.org/dwc/terms/lifeStage
Description	An age class or life stage of a dwc:Organism.
Comments	Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`zygote` `larva` `juvenile` `adult` `seedling` `flowering` `fruiting`
Type	string
Format	default

reproductiveCondition

Title (Label)	Reproductive Condition
Namespace	dwc
Table:	Occurrence
IRI	http://rs.tdwg.org/dwc/terms/reproductiveCondition
Description	A reproductive condition of a dwc:Organism.
Comments	Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`non-reproductive` `pregnant` `in bloom` `fruit-bearing`
Type	string
Format	default

caste

Title (Label)	Caste
Namespace	dwc
Table:	Occurrence
IRI	http://rs.tdwg.org/dwc/terms/caste
Description	A social caste of a dwc:Organism.
Comments	Recommended best practice is to use a controlled vocabulary that aligns best with a dwc:Taxon. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`queen` `male alate` `intercaste` `soldier` `ergatoid`
Type	string
Format	default

behavior

Title (Label)	Behavior
Namespace	dwc
Table:	Occurrence
IRI	http://rs.tdwg.org/dwc/terms/behavior
Description	A behavior shown by a dwc:Organism.
Comments	This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`roosting` `foraging` `running`
Type	string
Format	default

vitality

Title (Label)	Vitality
Namespace	dwc
Table:	Occurrence
IRI	http://rs.tdwg.org/dwc/terms/vitality
Description	An indication of whether a dwc:Organism was alive or dead at the time of collection or observation.
Comments	Recommended best practice is to use a controlled vocabulary. Intended to be used with records having a dwc:basisOfRecord of 'PreservedSpecimen', 'MaterialEntity', 'MaterialSample', 'HumanObservation', or 'MachineObservation'. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`alive` `dead` `mixedLot` `uncertain` `notAssessed`
Type	string
Format	default

establishmentMeans

Title (Label)	Establishment Means
Namespace	dwc
Table:	Occurrence
IRI	http://rs.tdwg.org/dwc/terms/establishmentMeans
Description	Statement about whether a dwc:Organism has been introduced to a given place and time through the direct or indirect activity of modern humans.
Comments	Recommended best practice is to use controlled value strings from the controlled vocabulary designated for use with this term, listed at http://rs.tdwg.org/dwc/doc/em/. For details, refer to https://doi.org/10.3897/biss.3.38084. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`native` `nativeIntroduced` `introduced` `introducedAssistedColinisation` `vagrant` `uncertain`
Type	string
Format	default

degreeOfEstablishment

Title (Label)	Degree Of Establishment
Namespace	dwc
Table:	Occurrence
IRI	http://rs.tdwg.org/dwc/terms/degreeOfEstablishment
Description	The degree to which a dwc:Organism survives, reproduces, and expands its range at a given place and time.
Comments	Recommended best practice is to use controlled value strings from the controlled vocabulary designated for use with this term, listed at http://rs.tdwg.org/dwc/doc/doe/. For details, refer to https://doi.org/10.3897/biss.3.38084. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`native` `captive` `cultivated` `released` `failing` `casual` `reproducing` `established` `colonising` `invasive` `widespreadInvasive`
Type	string
Format	default

pathway

Title (Label)	Pathway
Namespace	dwc
Table:	Occurrence
IRI	http://rs.tdwg.org/dwc/terms/pathway
Description	A process by which a dwc:Organism came to be in a given place at a given time.
Comments	Recommended best practice is to use controlled value strings from the controlled vocabulary designated for use with this term, listed at http://rs.tdwg.org/dwc/doc/pw/. For details, refer to https://doi.org/10.3897/biss.3.38084. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`releasedForUse` `otherEscape` `transportContaminant` `transportStowaway` `corridor` `unaided`
Type	string
Format	default

substrate

Title (Label)	Substrate
Namespace	dwc
Table:	Occurrence
IRI	http://rs.tdwg.org/dwc/terms/substrate
Description	A biotic or abiotic material to which an dwc:Organism is attached when a dwc:Event occurs.
Comments	This may or may not imply that the organism influenced/took resources from the substrate (such as during parasitization or decomposition). Declaration of a host-parasite relationship is better expressed as an organism interaction.
Examples	`stone` `wall` `decaying wood` `wooden board fence` `animal bones`
Type	string
Format	default

occurrenceStatus

Title (Label)	Occurrence Status
Namespace	dwc
Table:	Occurrence
IRI	http://rs.tdwg.org/dwc/terms/occurrenceStatus
Description	A statement about the detection or non-detection of a dwc:Organism.
Comments	For dwc:Occurrences, the default vocabulary is recommended to consist of 'detected' and 'notDetected', but can be extended by implementers with good justification. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`detected` `notDetected`
Type	string
Default	detected
Format	default

occurrenceReferences

Title (Label)	Occurrence References
Namespace	dwc
Table:	Occurrence
IRI	http://rs.tdwg.org/dwc/terms/associatedReferences
Description	A list (concatenated and separated) of identifiers (publication, bibliographic reference, global unique identifier, URI) of literature associated with a dwc:Occurrence.
Comments	Recommended best practice is to separate the values in a list with space vertical bar space (` \| `).
Examples	`Christopher J. Conroy, Jennifer L. Neuwald. 2008. Phylogeographic study of the California vole, Microtus californicus Journal of Mammalogy, 89(3):755-767.` `Steven R. Hoofer and Ronald A. Van Den Bussche. 2001. Phylogenetic Relationships of Plecotine Bats and Allies Based on Mitochondrial Ribosomal Sequences. Journal of Mammalogy 82(1):131-137. \| Walker, Faith M., Jeffrey T. Foster, Kevin P. Drees, Carol L. Chambers. 2014. Spotted bat (Euderma maculatum) microsatellite discovery using illumina sequencing. Conservation Genetics Resources.`
Type	string
Format	default

informationWithheld

Title (Label)	Information Withheld
Namespace	dwc
Table:	Occurrence
IRI	http://rs.tdwg.org/dwc/terms/informationWithheld
Description	Additional information that exists, but that has not been shared in the given record.
Examples	`location information not given for endangered species` `collector identities withheld \| ask about tissue samples`
Type	string
Format	default

dataGeneralizations

Title (Label)	Data Generalizations
Namespace	dwc
Table:	Occurrence
IRI	http://rs.tdwg.org/dwc/terms/dataGeneralizations
Description	Actions taken to make the shared data less specific or complete than in its original form. Suggests that alternative data of higher quality may be available on request.
Examples	`coordinates generalized from original GPS coordinates to the nearest half degree grid cell`
Type	string
Format	default

occurrenceRemarks

Title (Label)	Occurrence Remarks
Namespace	dwc
Table:	Occurrence
IRI	http://rs.tdwg.org/dwc/terms/occurrenceRemarks
Description	Comments or notes about a dwc:Occurrence.
Examples	`found dead on road`
Type	string
Format	default

organismID

Title (Label)	Organism ID
Namespace	dwc
Table:	Occurrence
IRI	http://rs.tdwg.org/dwc/terms/organismID
Description	An identifier for a dwc:Organism.
Type	string
Format	default

organismScope

Title (Label)	Organism Scope
Namespace	dwc
Table:	Occurrence
IRI	http://rs.tdwg.org/dwc/terms/organismScope
Description	A description of the type of dwc:Organism instance.
Comments	Recommended best practice is to use a controlled vocabulary. Can be used to indicate whether a dwc:Organism instance represents a discrete organism or if it represents a particular type of aggregation.
Examples	`multicellular organism` `virus` `clone` `pack` `colony`
Type	string
Format	default

organismName

Title (Label)	Organism Name
Namespace	dwc
Table:	Occurrence
IRI	http://rs.tdwg.org/dwc/terms/organismName
Description	A name or label assigned to a dwc:Organism.
Examples	`Huberta` `Boab Prison Tree` `J pod`
Type	string
Format	default

causeOfDeath

Title (Label)	Cause Of Death
Namespace	dwc
Table:	Occurrence
IRI	http://rs.tdwg.org/dwc/terms/causeOfDeath
Description	An indication of the known or suspected cause of death of a dwc:Organism.
Comments	The cause may be due to natural causes (e.g., disease, predation), human-related activities (e.g., roadkill, pollution), or other environmental factors (e.g., extreme weather events).
Examples	`trapped` `poisoned` `starved` `drowned` `shot` `old age` `roadkill` `disease` `herbicide` `burned` `infanticide`
Type	string
Format	default

organismRemarks

Title (Label)	Organism Remarks
Namespace	dwc
Table:	Occurrence
IRI	http://rs.tdwg.org/dwc/terms/organismRemarks
Description	Comments or notes about a dwc:Organism.
Type	string
Format	default

verbatimIdentification

Title (Label)	Verbatim Identification
Namespace	dwc
Table:	Occurrence
IRI	http://rs.tdwg.org/dwc/terms/verbatimIdentification
Description	A string representing a taxonomic identification as it appeared in the original record.
Type	string
Format	default

taxonFormula

Title (Label)	Taxon Formula
Namespace	dwcdp
Table:	Occurrence
Description	A string representing the pattern to use to construct a dwc:Identification from dwc:Taxon names and identification qualifiers.
Comments	Recommended best practice is to use a controlled vocabulary such as https://arctos.database.museum/info/ctDocumentation.cfm?table=cttaxa_formula.
Examples	`A` `A ?` `A or B` `A and B` `A x B` `A cf.` `A aff.`
Type	string
Default	A
Format	default

identifiedBy

Title (Label)	Identified By
Namespace	dwc
Table:	Occurrence
IRI	http://rs.tdwg.org/dwc/terms/identifiedBy
Description	A list (concatenated and separated) of names of Agents responsible for making a taxonomic determination of a dwc:Organism.
Comments	When used in the context of a Survey, the subject consists of all of the dwc:Identifications related to the Event. Recommended best practice is to separate the values in a list with space vertical bar space ( \| ).
Examples	`James L. Patton` `Theodore Pappenfuss \| Robert Macey`
Type	string
Format	default

identifiedByID

Title (Label)	Identified By ID
Namespace	dwc
Table:	Occurrence
IRI	http://rs.tdwg.org/dwc/terms/identifiedByID
Description	An identifier for the Agent responsible for making a taxonomic determination of a dwc:Organism.
Comments	When used in the context of a Survey, the subject consists of all of the dwc:Identifications related to the Survey. Recommended best practice is to provide a single identifier that disambiguates the details of the identifying agent. If a list is used, the order of the identifiers on the list should not be assumed to convey any semantics. Recommended best practice is to separate the values in a list with space vertical bar space (` \| `).
Examples	`https://orcid.org/0000-0002-1825-0097`
Type	string
Format	default

dateIdentified

Title (Label)	Date Identified
Namespace	dwc
Table:	Occurrence
IRI	http://rs.tdwg.org/dwc/terms/dateIdentified
Description	A date on which the subject was determined as representing a dwc:Taxon.
Comments	Recommended best practice is to use a date that conforms to ISO 8601-1:2019.
Examples	`2023-05-04`
Type	string
Format	default

identificationReferences

Title (Label)	Identification References
Namespace	dwc
Table:	Occurrence
IRI	http://rs.tdwg.org/dwc/terms/identificationReferences
Description	A list (concatenated and separated) of identifiers for References (publication, bibliographic reference, global unique identifier, URI, metabarcoding reference database) used in a dwc:Identification.
Comments	When used in the context of a Survey, the subject consists of all of the dwc:Identifications related to the Survey. Recommended best practice is to separate the values in a list with space vertical bar space (` \| `).
Examples	`Aves del Noroeste Patagonico. Christie et al. 2004.` `Stebbins, R. Field Guide to Western Reptiles and Amphibians. 3rd Edition. 2003. \| Irschick, D.J. and Shaffer, H.B. (1997). The polytypic species revisited: Morphological differentiation among tiger salamanders (Ambystoma tigrinum) (Amphibia: Caudata). Herpetologica, 53(1), 30-49.`
Type	string
Format	default

identificationVerificationStatus

Title (Label)	Identification Verification Status
Namespace	dwc
Table:	Occurrence
IRI	http://rs.tdwg.org/dwc/terms/identificationVerificationStatus
Description	A categorical indicator of the extent to which a taxonomic determination has been verified to be correct.
Comments	Recommended best practice is to use a controlled vocabulary such as that used in HISPID and ABCD.
Examples	`0` ('unverified' in HISPID/ABCD)
Type	string
Format	default

identificationRemarks

Title (Label)	Identification Remarks
Namespace	dwc
Table:	Occurrence
IRI	http://rs.tdwg.org/dwc/terms/identificationRemarks
Description	Comments or notes about a dwc:Identification.
Examples	`Distinguished between Anthus correndera and Anthus hellmayri based on the comparative lengths of the uñas.`
Type	string
Format	default

taxonID

Title (Label)	Taxon ID
Namespace	dwc
Table:	Occurrence
IRI	http://rs.tdwg.org/dwc/terms/taxonID
Description	An identifier for a dwc:Taxon.
Comments	In DwC-DP, the taxonID is always an external link to a taxon record. As such, if present, it should be a resolvable globally unique identifier. See the Identifiers section of https://github.com/CatalogueOfLife/coldp/blob/master/README.md.
Examples	`col:6W3C4` `worms:212808` `ipni:320035-2`
Type	string
Format	default

higherClassificationName

Title (Label)	Higher Classification Name
Namespace	dwcdp
Table:	Occurrence
Description	A full scientific name at a higher rank than the taxonRank of a dwc:scientificName.
Comments	A higherClassificationName must have a corresponding higherClassificationRank.
Examples	`Animalia` (higherClassificationName) with `kingdom` (higherClassificationRank) `Laphriinae` (higherClassificationName) with `subfamily` (higherClassificationRank)
Type	string
Format	default

higherClassificationRank

Title (Label)	Higher Classification Rank
Namespace	dwcdp
Table:	Occurrence
Description	A taxonomic rank of a higherClassificationName.
Comments	A higherClassificationRank must have a corresponding higherClassificationName.
Examples	`Acanthaceae` (higherClassificationName) with `family` (higherClassificationRank) `Pyrenomycetes` (higherClassificationName) with `class` (higherClassificationRank
Type	string
Format	default

scientificName

Title (Label)	Scientific Name
Namespace	dwc
Table:	Occurrence
IRI	http://rs.tdwg.org/dwc/terms/scientificName
Description	A full scientific name, with authorship and date information if known. When forming part of a dwc:Identification, this should be the name in lowest level taxonomic rank that can be determined. This term should not contain identification qualifications, which should instead be supplied in dwc:verbatimIdentification.
Type	string
Format	default

taxonRank

Title (Label)	Taxon Rank
Namespace	dwc
Table:	Occurrence
IRI	http://rs.tdwg.org/dwc/terms/taxonRank
Description	A taxonomic rank of the most specific name in a dwc:scientificName.
Type	string
Format	default

taxonRemarks

Title (Label)	Taxon Remarks
Namespace	dwc
Table:	Occurrence
IRI	http://rs.tdwg.org/dwc/terms/taxonRemarks
Description	Comments or notes about a dwc:Taxon.
Examples	`this name is a misspelling in common use`
Type	string
Format	default

feedbackURL

Title (Label)	Feedback URL
Namespace	dwc
Table:	Occurrence
IRI	http://rs.tdwg.org/dwc/terms/feedbackURL
Comments	A uniform resource locator (URL) that points to a webpage on which a form may be submitted to gather feedback about the record.
Type	string
Format	default

OrganismInteraction

Identifier: http://rs.tdwg.org/dwc/dwc-dp/organism-interaction

Description: An interaction between two dwc:Organisms during a dwc:Event.

Comments: Supports only primary observed interactions, not habitual or derived taxon-level interactions. Pairwise interactions must be used to represent multi-organism interactions. When possible, typify the action rather than the state from which an action is inferred, with the actor as the subject dwc:Occurrence and the acted-upon as the related dwc:Occurrence. Only one direction of a two-way interaction is necessary, though both are permissible as distinct OrganismInteractions with distint subject dwc:Occurrences.

Examples:

`a bee visiting a flower`

`a Mallophora ruficauda hunting an Apis mellifera in flight`

`a viral infection in a plant`

`a female spider mating with a male spider`

`a lion cub nursing from its mother`

`a mosquito sucking blood from a chimpanzee's arm`

`a slug eating a fungus growing on decomposing stump (2 interactions)`

Relationships to Other Tables

Field	Target Table	Target Field	Required
eventID	event	eventID	Yes
subjectOccurrenceID	occurrence	occurrenceID	Yes
relatedOccurrenceID	occurrence	occurrenceID	Yes

organismInteractionID

Title (Label)	Organism Interaction ID
Namespace	dwcdp
Table:	OrganismInteraction
Description	An identifier for an OrganismInteraction.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': True}
Format	default

eventID

Title (Label)	Event ID
Namespace	dwc
Table:	OrganismInteraction
IRI	http://rs.tdwg.org/dwc/terms/eventID
Description	An identifier for a dwc:Event.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

organismInteractionDescription

Title (Label)	Organism Interaction Description
Namespace	dcterms
Table:	OrganismInteraction
IRI	http://purl.org/dc/terms/description
Description	A verbatim description of an OrganismInteraction.
Examples	`Mallophora ruficauda capturing an Apis mellifera worker in flight.`
Type	string
Format	default

subjectOccurrenceID

Title (Label)	Subject Occurrence ID
Namespace	dwcdp
Table:	OrganismInteraction
IRI	http://rs.tdwg.org/dwc/terms/resourceID
Description	An identifier for a subject dwc:Occurrence in an OrganismInteraction.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

subjectOrganismPart

Title (Label)	Subject Organism Part
Namespace	dwcdp
Table:	OrganismInteraction
Description	A part of a subject dwc:Organism involved in an OrganismInteraction.
Examples	`stomach`
Type	string
Format	default

organismInteractionType

Title (Label)	Organism Interaction Type
Namespace	dwcdp
Table:	OrganismInteraction
Description	A category that best matches the nature of an OrganismInteraction.
Comments	Recommended best practice is to use a controlled vocabulary.
Examples	`visited flower of` `pollinated by` `parasitoid of` `mated with` `was attached to`
Type	string
Format	default

relatedOccurrenceID

Title (Label)	Related Occurrence ID
Namespace	dwcdp
Table:	OrganismInteraction
IRI	http://rs.tdwg.org/dwc/terms/relatedResourceID
Description	An identifier for a related dwc:Occurrence in an OrganismInteraction.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

relatedOrganismPart

Title (Label)	Related Organism Part
Namespace	dwcdp
Table:	OrganismInteraction
Description	A part of a object dwc:Organism involved in an OrganismInteraction.
Examples	`flower`
Type	string
Format	default

feedbackURL

Title (Label)	Feedback URL
Namespace	dwc
Table:	OrganismInteraction
IRI	http://rs.tdwg.org/dwc/terms/feedbackURL
Comments	A uniform resource locator (URL) that points to a webpage on which a form may be submitted to gather feedback about the record.
Type	string
Format	default

Survey

Identifier: http://rs.tdwg.org/dwc/dwc-dp/survey

Description: A biotic survey.

Comments: This class consists of the information you might find in the Humboldt Extension to Darwin Core, except for the target scope terms, which are here accommodated in SurveyTarget.

Examples:

`a botanical survey of a protected area to assess native and invasive plant species`

`a wetland vegetation mapping`

`a camera trap deployment in a rainforest to monitor large mammals`

`a frog call survey in wetlands across breeding seasons`

`a coverboard survey for reptiles in forested environments`

`a pollinator survey in an agricultural landscape`

`a macroinvertebrate sampling in a freshwater stream to assess water quality`

`a habitat- or ecosystem-level survey (e.g., coral reef health assessment, forest biodiversity assessment)`

`an environmental impact assessment (e.g., pre-construction biological baseline survey for a wind farm project)`

Relationships to Other Tables

Field	Target Table	Target Field	Required
eventID	event	eventID	Yes
identifiedByID	agent	agentID	No
samplingPerformedByID	agent	agentID	No
samplingEffortProtocolID	protocol	protocolID	No

surveyID

Title (Label)	Survey ID
Namespace	dwcdp
Table:	Survey
Description	An identifier for a Survey.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': True}
Format	default

eventID

Title (Label)	Event ID
Namespace	dwcdp
Table:	Survey
IRI	http://rs.tdwg.org/dwc/terms/eventID
Description	An identifier for a dwc:Event.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

siteCount

Title (Label)	Site Count
Namespace	eco
Table:	Survey
IRI	http://rs.tdwg.org/eco/terms/siteCount
Description	Total number of individual sites surveyed during a dwc:Event.
Comments	Site refers to the location at which observations are made or samples/measurements are taken. The site can be at any level of hierarchy.
Examples	`1` `15`
Type	integer
Constraints	{'required': False, 'minimum': 1}
Format	default

siteNestingDescription

Title (Label)	Site Nesting Description
Namespace	eco
Table:	Survey
IRI	http://rs.tdwg.org/eco/terms/siteNestingDescription
Description	Textual description of a hierarchical sampling design.
Comments	Site refers to the location at which observations are made or samples/measurements are taken. The site can be at any level of hierarchy.
Examples	`5 sampling sites of 3-5 plots each.`
Type	string
Format	default

verbatimSiteDescriptions

Title (Label)	Verbatim Site Descriptions
Namespace	eco
Table:	Survey
IRI	http://rs.tdwg.org/eco/terms/verbatimSiteDescriptions
Description	Original textual description of site(s).
Comments	Site refers to the location at which observations are made or samples/measurements are taken. The site can be at any level of hierarchy. Recommended best practice is to separate multiple values in a list with space vertical bar space ( \| ).
Examples	`Wet flatwoods \| Wet depression surrounded by mesic longleaf pine flatwoods \| Ground cover of thick Andropogon spp., Sporobolus floridanus, Vaccinium spp, Rhynchospora spp., Centella erecta, Panicum rigidulum.`
Type	string
Format	default

verbatimSiteNames

Title (Label)	Verbatim Site Names
Namespace	eco
Table:	Survey
IRI	http://rs.tdwg.org/eco/terms/verbatimSiteNames
Description	A list (concatenated and separated) of original site names.
Comments	Site refers to the location at which observations are made or samples/measurements are taken. The site can be at any level of hierarchy. Recommended best practice is to separate multiple values in a list with space vertical bar space ( \| ).
Examples	`East Coastal Fringe \| St. Marks Wildlife Management Area` `S1 \| S2 \| C1 \| C2 \| R14 \| R22 \| W1`
Type	string
Format	default

geospatialScopeAreaValue

Title (Label)	Geospatial Scope Area Value
Namespace	eco
Table:	Survey
IRI	http://rs.tdwg.org/eco/terms/geospatialScopeAreaValue
Description	The numeric value for the total area of a geospatial scope of a dwc:Event.
Comments	Geospatial scope refers to a dwc:Event location reported using the terms organized in Darwin Core under dcterms:Location. This area is always greater than or equal to the eco:totalAreaSampledValue. An eco:geospatialScopeAreaValue must have a corresponding eco:geospatialScopeAreaUnit.
Examples	`25`
Type	number
Constraints	{'required': False, 'minimum': 0}
Format	default

geospatialScopeAreaUnit

Title (Label)	Geospatial Scope Area Unit
Namespace	eco
Table:	Survey
IRI	http://rs.tdwg.org/eco/terms/geospatialScopeAreaUnit
Description	Units associated with a value in eco:geospatialScopeAreaValue.
Comments	Recommended best practice is to use a controlled vocabulary. For units containing exponents, use characters from the Unicode Latin-1 Supplement character set (hex 00B2 for squared and 00B3 for cubed). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`km²`
Type	string
Format	default

totalAreaSampledValue

Title (Label)	Total Area Sampled Value
Namespace	eco
Table:	Survey
IRI	http://rs.tdwg.org/eco/terms/totalAreaSampledValue
Description	The numeric value for the total area surveyed during a dwc:Event.
Comments	This area is always less than or equal to the eco:geospatialScopeAreaValue. An eco:totalAreaSampledValue must have a corresponding eco:totalAreaSampledUnit.
Examples	`0.8`
Type	number
Constraints	{'required': False, 'minimum': 0}
Format	default

totalAreaSampledUnit

Title (Label)	Total Area Sampled Unit
Namespace	eco
Table:	Survey
IRI	http://rs.tdwg.org/eco/terms/totalAreaSampledUnit
Description	Units associated with a value in eco:totalAreaSampledValue.
Comments	Recommended best practice is to use a controlled vocabulary. For units containing exponents, use characters from the Unicode Latin-1 Supplement character set (hex 00B2 for squared and 00B3 for cubed). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`km²`
Type	string
Format	default

reportedWeather

Title (Label)	Reported Weather
Namespace	eco
Table:	Survey
IRI	http://rs.tdwg.org/eco/terms/reportedWeather
Description	A list of weather or climatic conditions present during a dwc:Event.
Comments	Recommended best practice is to use a key:value encoding schema for a data interchange format such as JSON.
Examples	`{"minimumTemperatureInDegreesFahrenheit": 18, "maximumTemperatureInDegreesFahrenheit": 32}`
Type	string
Format	default

reportedExtremeConditions

Title (Label)	Reported Extreme Conditions
Namespace	eco
Table:	Survey
IRI	http://rs.tdwg.org/eco/terms/reportedExtremeConditions
Description	A description of any extreme weather or environmental conditions that may have affected a dwc:Event.
Examples	`flooding during week 3 of surveys` `rockslide at site 2`
Type	string
Format	default

eventDurationValue

Title (Label)	Event Duration Value
Namespace	eco
Table:	Survey
IRI	http://rs.tdwg.org/eco/terms/eventDurationValue
Description	The numeric value for the duration of a dwc:Event.
Examples	`An eco:eventDurationValue must have a corresponding eco:eventDurationUnit.`
Type	number
Constraints	{'required': False, 'minimum': 0}
Format	default

eventDurationUnit

Title (Label)	Event Duration Unit
Namespace	eco
Table:	Survey
IRI	http://rs.tdwg.org/eco/terms/eventDurationUnit
Description	Units associated with a value in eco:eventDurationValue.
Comments	Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`minutes` `hours` `days` `months` `years`
Type	string
Format	default

taxonCompletenessReported

Title (Label)	Taxon Completeness Reported
Namespace	eco
Table:	Survey
IRI	http://rs.tdwg.org/eco/terms/taxonCompletenessReported
Description	Statement about whether the taxonomic completeness of a dwc:Event was assessed.
Comments	This term is meant to alert users that the inventory was conducted in such a way that all of the target taxa (the combination of eco:targetTaxonomicScope and eco:excludedTaxonomicScope) should have been detectable if they were present during a dwc:Event. This term can provide data users with a qualitative measure of how comprehensively an area has been surveyed, which assists in interpreting species populations, areas of occupancy, inferring species absences, etc. This term is only relevant if a dwc:Event used restricted search or open search methods. If taxonomic completeness was assessed, the methods used or an explanation of the basis of the completeness should be stated in eco:taxonCompletenessProtocols. Recommended best practice is to use controlled value strings from the controlled vocabulary designated for use with this term, listed at http://rs.tdwg.org/dwc/doc/tcr/. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`notReported` `reportedComplete` `reportedIncomplete`
Type	string
Default	notReported
Format	default

taxonCompletenessProtocols

Title (Label)	Taxon Completeness Protocols
Namespace	eco
Table:	Survey
IRI	http://rs.tdwg.org/eco/terms/taxonCompletenessProtocols
Description	A description of or reference to the Protocols used to determine eco:taxonCompletenessReported.
Comments	This term allows users to determine how comprehensively an area has been sampled. Recommended best practice is to separate multiple values in a list with space vertical bar space ( \| ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`census \| based on sampling effort` `based on species accumulation curves`
Type	string
Format	default

isAbsenceReported

Title (Label)	Is Absence Reported
Namespace	eco
Table:	Survey
IRI	http://rs.tdwg.org/eco/terms/isAbsenceReported
Description	Taxonomic absences were reported.
Comments	Absences can be reported at any taxonomic level.
Examples	`true` `false`
Type	boolean
Format	default

absentTaxa

Title (Label)	Absent Taxa
Namespace	eco
Table:	Survey
IRI	http://rs.tdwg.org/eco/terms/absentTaxa
Description	A list (concatenated and separated) of taxa reported absent during a dwc:Event.
Comments	Absences can be reported at any taxonomic level. Recommended best practice is to separate multiple values in a list with space vertical bar space ( \| ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`Parabuteo unicinctus \| Geranoaetus melanoleucus` `Cetoniinae \| Aclopinae \| Cyclocephala modesta`
Type	string
Format	default

hasNonTargetTaxa

Title (Label)	Has Non Target Taxa
Namespace	eco
Table:	Survey
IRI	http://rs.tdwg.org/eco/terms/hasNonTargetTaxa
Description	One or more dwc:Organisms of taxa outside the target taxonomic scope (the combination of eco:targetTaxonomicScope and eco:excludedTaxonomicScope) were detected and reported for this dwc:Event.
Comments	This term is meant to alert users to the presence of non-target taxa (in some disciplines called “bycatch”) reported in this dwc:Event. This term is relevant only if a target taxonomic scope is declared. Taxonomic scope is based on the combination of eco:targetTaxonomicScope and eco:excludedTaxonomicScope. Examination of the taxonomic scope is needed in order to identify the non-target taxa. It should be possible to confirm the expectations by investigating a dwc:Occurrences in this dwc:Event and in its child dwc:Events (if available) or by exploring eco:nonTargetTaxa for this dwc:Event (if populated). The value of this term should be 'true' if dwc:Occurrences of taxa outside the taxonomic scope as defined at the time of a dwc:Event are reported, otherwise the value of this term should be 'false'.
Examples	`true` `false`
Type	boolean
Format	default

nonTargetTaxa

Title (Label)	Non Target Taxa
Namespace	eco
Table:	Survey
IRI	http://rs.tdwg.org/eco/terms/nonTargetTaxa
Description	A list (concatenated and separated) of taxa reported during a dwc:Event that are outside of the target taxonomic scope (the combination of eco:targetTaxonomicScope and eco:excludedTaxonomicScope).
Comments	This term is meant to allow the full list of taxa that are considered outside of the taxonomic scope and yet were reported in the dataset to be shared. This term is relevant only if a target taxonomic scope is declared and eco:hasNonTargetTaxa is ‘true’. Taxonomic scope is based on the combination of eco:targetTaxonomicScope and eco:excludedTaxonomicScope. Non-target taxa (in some disciplines called “bycatch”) can be reported at any taxonomic level. Recommended best practice is to separate multiple values in a list with space vertical bar space ( \| ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`Parabuteo unicinctus \| Geranoaetus melanoleucus` `Cetoniinae \| Aclopinae \| Cyclocephala modesta`
Type	string
Format	default

areNonTargetTaxaFullyReported

Title (Label)	Are Non Target Taxa Fully Reported
Namespace	eco
Table:	Survey
IRI	http://rs.tdwg.org/eco/terms/areNonTargetTaxaFullyReported
Description	Every dwc:Organism that was outside of the target taxonomic scope (the combination of eco:targetTaxonomicScope and eco:excludedTaxonomicScope) and detected during a dwc:Event, and that was detectable using the given protocol (given in eco:protocolDescriptions and dwc:samplingProtocol), was reported.
Comments	This term is meant to inform a user of the data whether there were non-target taxa that were detected, but left unreported. This term is only relevant if a dwc:Event used restricted search or open search methods and if a target taxonomic scope is declared. Taxonomic scope is based on the combination of eco:targetTaxonomicScope and eco:excludedTaxonomicScope. Within dwc:Events that used either a restricted search or an open search method and declared a taxonomic scope, if all dwc:Organisms that are not included within the target taxonomic scope and that were detected during a dwc:Event were reported, the value of this term should be 'true', otherwise the value of this term should be ‘false'.
Examples	`true` `false`
Type	boolean
Format	default

hasNonTargetOrganisms

Title (Label)	Has Non Target Organisms
Namespace	eco
Table:	Survey
IRI	http://rs.tdwg.org/eco/terms/hasNonTargetOrganisms
Description	One or more dwc:Organisms outside the target organismal scopes (eco:targetDegreeOfEstablishmentScope, eco:targetGrowthFormScope, and eco:targetLifeStageScope) were detected and reported for this dwc:Event.
Comments	This term is meant to alert users to the presence of non-target organisms (in some disciplines called “bycatch”) reported in this dwc:Event. This term is relevant only if a target organismal scope is declared. Organismal scope is based on the combination of all of the following terms: eco:targetLifeStageScope, eco:excludedLifeStageScope, eco:targetDegreeOfEstablishmentScope, eco:excludedDegreeOfEstablishmentScope, eco:targetGrowthFormScope, and eco:excludedGrowthFormScope. Examination of the organismal scope is needed in order to identify the non-target dwc:Organisms. It should be possible to confirm the expectations by investigating a dwc:Occurrences in this dwc:Event and in its child dwc:Events (if available). The value of this term should be 'true' if dwc:Occurrences of dwc:Organisms outside the organismal scope(s) as defined at the time of a dwc:Event are reported, otherwise the value of this term should be 'false'.
Examples	`true` `false`
Type	boolean
Format	default

verbatimTargetScope

Title (Label)	Verbatim Target Scope
Namespace	dwcdp
Table:	Survey
Description	A verbatim original description of a dwc:Event scope.
Comments	Recommended best practice is first to populate explicit scope terms to the fullest extent possible (e.g., eco:targetTaxonomicScope). It is not recommended to use this term in assessing absence or completeness.
Examples	`small mammals` `freshwater macroinvertebrates` `dead animals, ground-living insects`
Type	string
Format	default

identifiedBy

Title (Label)	Identified By
Namespace	dwc
Table:	Survey
IRI	http://rs.tdwg.org/dwc/terms/identifiedBy
Description	A list (concatenated and separated) of names of Agents responsible for making a taxonomic determination of a dwc:Organism.
Comments	When used in the context of a Survey, the subject consists of all of the dwc:Identifications related to the Event. Recommended best practice is to separate the values in a list with space vertical bar space ( \| ).
Examples	`James L. Patton` `Theodore Pappenfuss \| Robert Macey`
Type	string
Format	default

identifiedByID

Title (Label)	Identified By ID
Namespace	dwc
Table:	Survey
IRI	http://rs.tdwg.org/dwc/terms/identifiedByID
Description	An identifier for an Agent responsible for making a taxonomic determination of a dwc:Organism.
Comments	When used in the context of a Survey, the subject consists of all of the dwc:Identifications related to the Survey. Recommended best practice is to provide a single identifier that disambiguates the details of the identifying agent. If a list is used, the order of the identifiers on the list should not be assumed to convey any semantics. Recommended best practice is to separate the values in a list with space vertical bar space (` \| `).
Examples	`https://orcid.org/0000-0002-1825-0097`
Type	string
Format	default

identificationReferences

Title (Label)	Identification References
Namespace	dwc
Table:	Survey
IRI	http://rs.tdwg.org/dwc/terms/identificationReferences
Description	A list (concatenated and separated) of identifiers for References (publication, bibliographic reference, global unique identifier, URI, metabarcoding reference database) used in a dwc:Identification.
Comments	When used in the context of a Survey, the subject consists of all of the dwc:Identifications related to the Survey. Recommended best practice is to separate the values in a list with space vertical bar space (` \| `).
Examples	`Aves del Noroeste Patagonico. Christie et al. 2004.` `Stebbins, R. Field Guide to Western Reptiles and Amphibians. 3rd Edition. 2003. \| Irschick, D.J. and Shaffer, H.B. (1997). The polytypic species revisited: Morphological differentiation among tiger salamanders (Ambystoma tigrinum) (Amphibia: Caudata). Herpetologica, 53(1), 30-49.`
Type	string
Format	default

compilationTypes

Title (Label)	Compilation Types
Namespace	eco
Table:	Survey
IRI	http://rs.tdwg.org/eco/terms/compilationTypes
Description	A statement specifying whether data reported are derived from sampling events, ancillary data compiled from other sources, or a combination of both.
Comments	This term is only relevant if a dwc:Event is an inventory. Recommended best practice is to use a controlled vocabulary. Recommended best practice is to separate the values in a list with space vertical bar space ( \| ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`samplingEvents` `compilationOfExistingSourcesAndSamplingEvents` `compilationOfExistingSources` `compilationOfExistingSourcesAndSamplingEvents \| compilationOfExistingSources`
Type	string
Format	default

compilationSourceTypes

Title (Label)	Compilation Source Types
Namespace	eco
Table:	Survey
IRI	http://rs.tdwg.org/eco/terms/compilationSourceTypes
Description	The types of data sources contributing to the compilation reported.
Comments	This term is only relevant if a dwc:Event is a compilation in which one or more types of data sources were used. Recommended best practice is to use a controlled vocabulary and separate multiple values in a list with space vertical bar space ( \| ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`museumSpecimens` `literature` `expertKnowledge \| localKnowledge`
Type	string
Format	default

inventoryTypes

Title (Label)	Inventory Types
Namespace	eco
Table:	Survey
IRI	http://rs.tdwg.org/eco/terms/inventoryTypes
Description	The types of search processes used to conduct the inventory.
Comments	This term is only relevant if a dwc:Event represents an inventory. Recommended best practice is to use a controlled vocabulary. Recommended best practice is to separate multiple values in a list with space vertical bar space ( \| ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`restrictedSearch` `openSearch` `opportunisticSearch` `adventitious` `compilation` `openSearch \| opportunisticSearch`
Type	string
Format	default

protocolNames

Title (Label)	Protocol Names
Namespace	eco
Table:	Survey
IRI	http://rs.tdwg.org/eco/terms/protocolNames
Description	Categorical descriptive names for the Protocols used during a dwc:Event.
Comments	Recommended best practice is to use a controlled vocabulary and separate multiple values in a list with space vertical bar space ( \| ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`boxTrapping` `floraInventory` `boxTrapping \| funnelTrapping`
Type	string
Format	default

protocolDescriptions

Title (Label)	Protocol Descriptions
Namespace	eco
Table:	Survey
IRI	http://rs.tdwg.org/eco/terms/protocolDescriptions
Description	A detailed description of the Protocols used during a dwc:Event.
Comments	This description should be associated with protocols provided in eco:protocolNames. The description may include deviations from a protocol referred to in eco:protocolReferences. Recommended good practice is to provide information about instruments used, calibration, etc. Recommended best practice is to separate multiple values in a list with space vertical bar space ( \| ).
Examples	`Three conventional harp traps (3.2m ht x 2.2m w) were established in flight path zones for a period of 4 hrs at dawn and dusk for a total of 10 trap nights. Traps were visited on an hourly basis during each deployment period and the trap catch recorded for species, size, weight, sex, age and maternal status.`
Type	string
Format	default

protocolReferences

Title (Label)	Protocol References
Namespace	eco
Table:	Survey
IRI	http://rs.tdwg.org/eco/terms/protocolReferences
Description	A list (concatenated and separated) of identifiers for References (publication, bibliographic reference, global unique identifier, URI, metabarcoding reference database) used during a dwc:Event.
Comments	Recommended best practice is to separate multiple values in a list with space vertical bar space ( \| ).
Examples	`Penguins from space: faecal stains reveal the location of emperor penguin colonies, https://doi.org/10.1111/j.1466-8238.2009.00467.x`
Type	string
Format	default

isAbundanceReported

Title (Label)	Is Abundance Reported
Namespace	eco
Table:	Survey
IRI	http://rs.tdwg.org/eco/terms/isAbundanceReported
Description	The number of dwc:Organisms collected or observed was reported.
Comments	Typically the abundance values would be reported in a dwc:organismQuantity and dwc:organismQuantityType terms for the child dwc:Occurrence records for this dwc:Event.
Examples	`true` `false`
Type	boolean
Format	default

isAbundanceCapReported

Title (Label)	Is Abundance Cap Reported
Namespace	eco
Table:	Survey
IRI	http://rs.tdwg.org/eco/terms/isAbundanceCapReported
Description	A maximum number of dwc:Organisms was reported, as specified or restricted by the protocol used.
Comments	Values of abundance cap should be captured under the term eco:abundanceCap.
Examples	`true` `false`
Type	boolean
Format	default

abundanceCap

Title (Label)	Abundance Cap
Namespace	eco
Table:	Survey
IRI	http://rs.tdwg.org/eco/terms/abundanceCap
Description	The reported maximum number of dwc:Organisms.
Examples	`300` `700`
Type	integer
Constraints	{'required': False, 'minimum': 0}
Format	default

isVegetationCoverReported

Title (Label)	Is Vegetation Cover Reported
Namespace	eco
Table:	Survey
IRI	http://rs.tdwg.org/eco/terms/isVegetationCoverReported
Description	A vegetation cover metric was reported.
Comments	Typically values or descriptions of vegetation cover would be captured under the term eco:verbatimSiteDescriptions.
Examples	`true` `false`
Type	boolean
Format	default

isLeastSpecificTargetCategoryQuantityInclusive

Title (Label)	Is Least Specific Target Category Quantity Inclusive
Namespace	eco
Table:	Survey
IRI	http://rs.tdwg.org/eco/terms/isLeastSpecificTargetCategoryQuantityInclusive
Description	The total detected quantity for a dwc:Taxon (including subcategories thereof) in a dwc:Event is given explicitly in a single record (dwc:organismQuantity value) for that dwc:Taxon.
Comments	Recommended values are 'true' and 'false'. This term is only relevant if dwc:organismQuantity is a number. For a detailed explanation, see http://rs.tdwg.org/dwc/doc/inclusive/.
Examples	`true` `false`
Type	boolean
Format	default

hasVouchers

Title (Label)	Has Vouchers
Namespace	eco
Table:	Survey
IRI	http://rs.tdwg.org/eco/terms/hasVouchers
Description	Specimen vouchers were collected during a dwc:Event.
Examples	`true` `false`
Type	boolean
Format	default

voucherInstitutions

Title (Label)	Voucher Institutions
Namespace	eco
Table:	Survey
IRI	http://rs.tdwg.org/eco/terms/voucherInstitutions
Description	A list (concatenated and separated) of the names or acronyms of the institutions where vouchers collected during a dwc:Event were deposited.
Comments	Recommended best practice is to separate multiple values in a list with space vertical bar space ( \| ).
Examples	`FMNH` `AMNH \| MVZ` `Nairobi National Museum`
Type	string
Format	default

hasMaterialSamples

Title (Label)	Has Material Samples
Namespace	eco
Table:	Survey
IRI	http://rs.tdwg.org/eco/terms/hasMaterialSamples
Description	Material samples were collected during a dwc:Event.
Examples	`true` `false`
Type	boolean
Format	default

materialSampleTypes

Title (Label)	Material Sample Types
Namespace	eco
Table:	Survey
IRI	http://rs.tdwg.org/eco/terms/materialSampleTypes
Description	A list (concatenated and separated) of material sample types collected during a dwc:Event.
Comments	Recommended best practice is to use a controlled vocabulary and separate multiple values in a list with space vertical bar space ( \| ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`wholeOrganism` `skeleton` `tissue \| blood \| fecal \| stomachContent`
Type	string
Format	default

sampleSizeValue

Title (Label)	Sample Size Value
Namespace	dwc
Table:	Survey
IRI	http://rs.tdwg.org/dwc/terms/sampleSizeValue
Description	A numeric value for a measurement of the size (time duration, length, area, or volume) of a sample in a sampling dwc:Event.
Comments	A dwc:sampleSizeValue must have a corresponding dwc:sampleSizeUnit.
Examples	`5` (sampleSizeValue) with `metre` (sampleSizeUnit)
Type	string
Format	default

sampleSizeUnit

Title (Label)	Sample Size Unit
Namespace	dwc
Table:	Survey
IRI	http://rs.tdwg.org/dwc/terms/sampleSizeUnit
Description	A unit of measurement of the size (time duration, length, area, or volume) of a sample in a sampling dwc:Event.
Comments	A dwc:sampleSizeUnit must have a corresponding dwc:sampleSizeValue, e.g., `5` for dwc:sampleSizeValue with `metre` for dwc:sampleSizeUnit.
Examples	`minute` `hour` `day` `metre` `square metre` `cubic metre``
Type	string
Format	default

samplingPerformedBy

Title (Label)	Sampling Performed By
Namespace	eco
Table:	Survey
IRI	http://rs.tdwg.org/eco/terms/samplingPerformedBy
Description	An Agent responsible for sampling.
Comments	The sampling dwc:Event could be at any level of hierarchy. In the case of a higher level (parent) dwc:Event, include all the organizations or people involved in the child dwc:Events that contributed to the parent dwc:Event. Recommended best practice is to separate multiple values in a list with space vertical bar space ( \| ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`North American Butterfly Association` `KK Wall` `JJ Green` `LL Pink and FF Grey \| Aspen Center for Environmental Studies`
Type	string
Format	default

samplingPerformedByID

Title (Label)	Sampling Performed By ID
Namespace	dwcdp
Table:	Survey
Description	An identifier for an Agent responsible for sampling.
Comments	Recommended best practice is to provide a single identifier that disambiguates the details of the sampling agent. If a list is used, the order of the identifiers on the list should not be assumed to convey any semantics. Recommended best practice is to separate the values in a list with space vertical bar space (` \| `).
Examples	`https://orcid.org/0000-0002-1825-0097`
Type	string
Format	default

isSamplingEffortReported

Title (Label)	Is Sampling Effort Reported
Namespace	eco
Table:	Survey
IRI	http://rs.tdwg.org/eco/terms/isSamplingEffortReported
Description	The sampling effort associated with a dwc:Event was reported.
Comments	Typically values of effort would be captured under the terms eco:samplingEffortValue and eco:samplingEffortUnit.
Examples	`true` `false`
Type	boolean
Format	default

samplingEffortProtocol

Title (Label)	Sampling Effort Protocol
Namespace	eco
Table:	Survey
IRI	http://rs.tdwg.org/eco/terms/samplingEffortProtocol
Description	A description of or reference to a Protocol used to determine a eco:samplingEffortValue.
Comments	This description should be associated with the values reported in eco:samplingEffortValue and eco:samplingEffortUnit. This is a specialization of eco:protocolDescriptions focused on effort, distinct from the survey method. The effort relates to the intensity of sampling and therefore can assist in interpreting estimates of completeness. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`40 box traps deployed at even spacings along 4 parallel 100m transects placed 50m apart and visited at 6 hourly intervals over a 48 hour period` `2 people occupying a bird hide for a period of 8 hours and undertaking a 30 minute count of species within the 150 degree field of view every 2 hours` `A single baited camera trap station with motion sensor trigger, deployed for a period of 10 days and configured for detecting large fauna moving through a known traffic way`
Type	string
Format	default

samplingEffortProtocolID

Title (Label)	Sampling Effort Protocol ID
Namespace	ecoiri
Table:	Survey
IRI	http://rs.tdwg.org/eco/iri/samplingEffortProtocol
Description	An identifier for a Protocol used to determine a eco:samplingEffortValue.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Format	default

samplingEffortValue

Title (Label)	Sampling Effort Value
Namespace	eco
Table:	Survey
IRI	http://rs.tdwg.org/eco/terms/samplingEffortValue
Description	The numeric value for the sampling effort expended during a dwc:Event.
Comments	This term is meant to capture the total sampling effort value. To express details of how the effort was determined use eco:samplingEffortProtocol. For compilations it is recommend not to infer effort. An eco:samplingEffortValue must have a corresponding eco:samplingEffortUnit.
Examples	`1900` `40` `5.5`
Type	number
Constraints	{'required': False, 'minimum': 0}
Format	default

samplingEffortUnit

Title (Label)	Sampling Effort Unit
Namespace	eco
Table:	Survey
IRI	http://rs.tdwg.org/eco/terms/samplingEffortUnit
Description	Units associated with a value in eco:samplingEffortValue.
Comments	Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`trapHours` `personHours` `trapDays`
Type	string
Format	default

informationWithheld

Title (Label)	Information Withheld
Namespace	dwc
Table:	Survey
IRI	http://rs.tdwg.org/dwc/terms/informationWithheld
Description	Additional information that exists, but that has not been shared in the given record.
Examples	`location information not given for endangered species` `collector identities withheld \| ask about tissue samples`
Type	string
Format	default

dataGeneralizations

Title (Label)	Data Generalizations
Namespace	dwc
Table:	Survey
IRI	http://rs.tdwg.org/dwc/terms/dataGeneralizations
Description	Actions taken to make the shared data less specific or complete than in its original form. Suggests that alternative data of higher quality may be available on request.
Examples	`coordinates generalized from original GPS coordinates to the nearest half degree grid cell`
Type	string
Format	default

feedbackURL

Title (Label)	Feedback URL
Namespace	dwc
Table:	Survey
IRI	http://rs.tdwg.org/dwc/terms/feedbackURL
Comments	A uniform resource locator (URL) that points to a webpage on which a form may be submitted to gather feedback about the record.
Type	string
Format	default

SurveyTarget

Identifier: http://rs.tdwg.org/dwc/dwc-dp/survey-target

Description: A specification of a characteristic of dwc:Occurrence that was included or excluded in a Survey.

Relationships to Other Tables

Field	Target Table	Target Field	Required
surveyID	survey	surveyID	Yes

surveyTargetID

Title (Label)	Survey Target ID
Namespace	dwcdp
Table:	SurveyTarget
Description	An identifier for a SurveyTarget.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

surveyID

Title (Label)	Survey ID
Namespace	dwcdp
Table:	SurveyTarget
Description	An identifier for a Survey.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

surveyTargetType

Title (Label)	Survey Target Type
Namespace	dwcdp
Table:	SurveyTarget
Description	A scope a SurveyTarget describes.
Comments	Recommended best practice is to use a controlled vocabulary.
Examples	`taxon` `habitat` `establishmentMeans` `growthForm` `sex` `lifeStage`
Type	string
Format	default

surveyTargetValue

Title (Label)	Survey Target Value
Namespace	dwcdp
Table:	SurveyTarget
Description	A value of a characteristic sought for the SurveyTarget for a given surveyTargetType.
Comments	Recommended best practice is to use a controlled vocabulary.
Examples	`Aves` `oak savannah` `native` `tree` `female` `adult` `height` `weight`
Type	string
Format	default

surveyTargetUnit

Title (Label)	Survey Target Unit
Namespace	dwcdp
Table:	SurveyTarget
Description	Units associated with a value in surveyTargetValue.
Comments	Recommended best practice is to use a controlled vocabulary.
Examples	`m` `g` `years`
Type	string
Format	default

includeOrExclude

Title (Label)	Include Or Exclude
Namespace	dwcdp
Table:	SurveyTarget
Description	A term to declare whether an instance of the SurveyTarget is an included scope or an excluded scope. Combinations of SurveyTarget records of inclusions and exclusions can define complex scopes such as all flying adult Aves except Passeriformes.
Comments	Recommended best practice is use a controlled vocabulary consisting of 'include' and 'exclude' only.
Examples	`include` `exclude`
Type	string
Default	include
Constraints	{'required': True, 'unique': False}
Format	default

isSurveyTargetFullyReported

Title (Label)	Is Survey Target Fully Reported
Namespace	dwcdp
Table:	SurveyTarget
Description	A declaration of whether the counts for an instance of the SurveyTarget report everything that matches the declared SurveyTarget. If they do, this enables inference of absence of detection for everything in that SurveyTarget that is included but that does not appear in the count.
Examples	`true` `false`
Type	boolean
Constraints	{'required': True, 'unique': False}
Format	default

Identification

Identifier: http://rs.tdwg.org/dwc/dwc-dp/identification

Description: A taxonomic determination (i.e., the assignment of dwc:Taxa to dwc:Organisms).

Examples:

`a subspecies determination of an organism`

`a nomenclatural act designating a specimen as a holotype`

`the determination of species of the furs of animals in a parka`

Relationships to Other Tables

Field	Target Table	Target Field	Required
basedOnOccurrenceID	occurrence	occurrenceID	No
basedOnMaterialEntityID	material	materialEntityID	No
basedOnNucleotideSequenceID	nucleotide-sequence	nucleotideSequenceID	No
basedOnNucleotideAnalysisID	nucleotide-analysis	nucleotideAnalysisID	No
basedOnMediaID	media	mediaID	No
identifiedByID	agent	agentID	No

identificationID

Title (Label)	Identification ID
Namespace	dwc
Table:	Identification
IRI	http://rs.tdwg.org/dwc/terms/identificationID
Description	An identifier for a dwc:Identification.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': True}
Format	default

basedOnOccurrenceID

Title (Label)	Based On Occurrence ID
Namespace	dwcdp
Table:	Identification
Description	An identifier for a dwc:Occurrence based on which a dwc:Identification was made.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Format	default

basedOnMaterialEntityID

Title (Label)	Based On Material Entity ID
Namespace	dwcdp
Table:	Identification
Description	An identifier for a dwc:MaterialEntity based on which a dwc:Identification was made.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Format	default

basedOnNucleotideSequenceID

Title (Label)	Based On Nucleotide Sequence ID
Namespace	dwcdp
Table:	Identification
Description	An identifier for a NucleotideSequence based on which a dwc:Identification was made.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Format	default

basedOnNucleotideAnalysisID

Title (Label)	Based On Nucleotide Analysis ID
Namespace	dwcdp
Table:	Identification
Description	An identifier for a NucleotideAnalysis based on which a dwc:Identification was made.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Format	default

basedOnMediaID

Title (Label)	Based On Media ID
Namespace	dwcdp
Table:	Identification
Description	An identifier for a Media instance based on which a dwc:Identification was made.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Format	default

identificationType

Title (Label)	Identification Type
Namespace	dwcdp
Table:	Identification
Description	A category that best matches the nature of a dwc:Identification.
Comments	Recommended best practice is to use a controlled vocabulary.
Examples	`GeneticSequence` `TaxonDistribution` `MaterialEntity` `Sound` `StillImage` `MovingImage` `Text` `HumanObservation` `MachineObservation`
Type	string
Format	default

verbatimIdentification

Title (Label)	Verbatim Identification
Namespace	dwc
Table:	Identification
IRI	http://rs.tdwg.org/dwc/terms/verbatimIdentification
Description	A string representing a taxonomic identification as it appeared in the original record.
Examples	`Ctenomys sociabilis` `social tuco-tuco` `Peromyscus sp.` `Ministrymon sp. nov. 1` `Anser anser × Branta canadensis` `Pachyporidae?`
Type	string
Format	default

isAcceptedIdentification

Title (Label)	Is Accepted Identification
Namespace	dwcdp
Table:	Identification
Description	A dwc:Identification of a dwc:Organism is a currently an accepted one.
Examples	`true` `false`
Type	boolean
Format	default

taxonFormula

Title (Label)	Taxon Formula
Namespace	dwcdp
Table:	Identification
Description	A string representing the pattern to use to construct a dwc:Identification from dwc:Taxon names and identification qualifiers.
Comments	Recommended best practice is to use a controlled vocabulary such as https://arctos.database.museum/info/ctDocumentation.cfm?table=cttaxa_formula.
Examples	`A` `A ?` `A or B` `A and B` `A x B` `A cf.` `A aff.`
Type	string
Default	A
Format	default

typeStatus

Title (Label)	Type Status
Namespace	dwc
Table:	Identification
IRI	http://rs.tdwg.org/dwc/terms/typeStatus
Description	A list (concatenated and separated) of nomenclatural types (type status, typified scientific name, publication) applied to the subject.
Comments	Recommended best practice is to separate the values in a list with space vertical bar space ( \| ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`holotype of Ctenomys sociabilis. Pearson O. P., and M. I. Christie. 1985. Historia Natural, 5(37):388` `holotype of Pinus abies \| holotype of Picea abies`
Type	string
Format	default

typeDesignationType

Title (Label)	typeDesignationType
Namespace	gbif
Table:	Identification
IRI	http://rs.gbif.org/terms/1.0/typeDesignationType
Description	A category that best matches the nature of a type designation.
Comments	From https://rs.gbif.org/extension/gbif/1.0/typesandspecimen.xml.
Examples	`monotypy` `original designation` `tautonomy`
Type	string
Format	default

identifiedBy

Title (Label)	Identified By
Namespace	dwc
Table:	Identification
IRI	http://rs.tdwg.org/dwc/terms/identifiedBy
Description	A list (concatenated and separated) of names of Agents responsible for making a taxonomic determination of a dwc:Organism.
Comments	When used in the context of a Survey, the subject consists of all of the dwc:Identifications related to the Event. Recommended best practice is to separate the values in a list with space vertical bar space ( \| ).
Examples	`James L. Patton` `Theodore Pappenfuss \| Robert Macey`
Type	string
Format	default

identifiedByID

Title (Label)	Identified By ID
Namespace	dwc
Table:	Identification
IRI	http://rs.tdwg.org/dwc/terms/identifiedByID
Description	An identifier for the Agent responsible for making a taxonomic determination of a dwc:Organism.
Comments	When used in the context of a Survey, the subject consists of all of the dwc:Identifications related to the Survey. Recommended best practice is to provide a single identifier that disambiguates the details of the identifying agent. If a list is used, the order of the identifiers on the list should not be assumed to convey any semantics. Recommended best practice is to separate the values in a list with space vertical bar space (` \| `).
Examples	`https://orcid.org/0000-0002-1825-0097`
Type	string
Format	default

dateIdentified

Title (Label)	Date Identified
Namespace	dwc
Table:	Identification
IRI	http://rs.tdwg.org/dwc/terms/dateIdentified
Description	A date on which the subject was determined as representing a dwc:Taxon.
Comments	Recommended best practice is to use a date that conforms to ISO 8601-1:2019.
Examples	`2023-05-04`
Type	string
Format	default

identificationReferences

Title (Label)	Identification References
Namespace	dwc
Table:	Identification
IRI	http://rs.tdwg.org/dwc/terms/identificationReferences
Description	A list (concatenated and separated) of identifiers for References (publication, bibliographic reference, global unique identifier, URI, metabarcoding reference database) used in a dwc:Identification.
Comments	When used in the context of a Survey, the subject consists of all of the dwc:Identifications related to the Survey. Recommended best practice is to separate the values in a list with space vertical bar space (` \| `).
Examples	`Aves del Noroeste Patagonico. Christie et al. 2004.` `Stebbins, R. Field Guide to Western Reptiles and Amphibians. 3rd Edition. 2003. \| Irschick, D.J. and Shaffer, H.B. (1997). The polytypic species revisited: Morphological differentiation among tiger salamanders (Ambystoma tigrinum) (Amphibia: Caudata). Herpetologica, 53(1), 30-49.` `UNITE v10.0, https://doi.org/10.15156/BIO/3301231`
Type	string
Format	default

taxonAssignmentMethod

Title (Label)	Taxon Assignment Method
Namespace	dwcdp
Table:	Identification
Description	Tool and thresholds used to compare sequences when computing 'species-level' OTUs.
Examples	`blastn 2.6.0+ e-value cutoff: 0.001 identity cutoff: 0.97`
Type	string
Format	default

identificationVerificationStatus

Title (Label)	Identification Verification Status
Namespace	dwc
Table:	Identification
IRI	http://rs.tdwg.org/dwc/terms/identificationVerificationStatus
Description	A categorical indicator of the extent to which a taxonomic determination has been verified to be correct.
Comments	Recommended best practice is to use a controlled vocabulary such as that used in HISPID and ABCD.
Examples	`0` ('unverified' in HISPID/ABCD)
Type	string
Format	default

identificationRemarks

Title (Label)	Identification Remarks
Namespace	dwc
Table:	Identification
IRI	http://rs.tdwg.org/dwc/terms/identificationRemarks
Description	Comments or notes about a dwc:Identification.
Examples	`Distinguished between Anthus correndera and Anthus hellmayri based on the comparative lengths of the uñas.`
Type	string
Format	default

taxonID

Title (Label)	Taxon ID
Namespace	dwc
Table:	Identification
IRI	http://rs.tdwg.org/dwc/terms/taxonID
Description	An identifier for a dwc:Taxon.
Comments	In DwC-DP, the taxonID is always an external link to a taxon record. As such, if present, it should be a resolvable globally unique identifier. See the Identifiers section of https://github.com/CatalogueOfLife/coldp/blob/master/README.md.
Examples	`col:6W3C4` `worms:212808` `ipni:320035-2`
Type	string
Format	default

higherClassificationName

Title (Label)	Higher Classification Name
Namespace	dwcdp
Table:	Identification
Description	A full scientific name at a higher rank than the taxonRank of dwc:scientificName.
Comments	A higherClassificationName must have a corresponding higherClassificationRank.
Examples	`Animalia` (higherClassificationName) with `kingdom` (higherClassificationRank) `Laphriinae` (higherClassificationName) with `subfamily` (higherClassificationRank)
Type	string
Format	default

higherClassificationRank

Title (Label)	Higher Classification Rank
Namespace	dwcdp
Table:	Identification
Description	A taxonomic rank of the higherClassificationName.
Comments	A higherClassificationRank must have a corresponding higherClassificationName.
Examples	`Acanthaceae` (higherClassificationName) with `family` (higherClassificationRank) `Pyrenomycetes` (higherClassificationName) with `class` (higherClassificationRank)
Type	string
Format	default

scientificName

Title (Label)	Scientific Name
Namespace	dwc
Table:	Identification
IRI	http://rs.tdwg.org/dwc/terms/scientificName
Description	A full scientific name, with authorship and date information if known. When forming part of a dwc:Identification, this should be the name in lowest level taxonomic rank that can be determined. This term should not contain identification qualifications, which should instead be supplied in dwc:verbatimIdentification.
Examples	`Coleoptera` (order) `Vespertilionidae` (family) `Manis` (genus) `Ctenomys sociabilis` (genus + specificEpithet) `Ambystoma tigrinum diaboli` (genus + specificEpithet + infraspecificEpithet) `Roptrocerus typographi (Györfi, 1952)` (genus + specificEpithet + scientificNameAuthorship) `Quercus agrifolia var. oxyadenia (Torr.) J.T. Howell` (genus + specificEpithet + taxonRank + infraspecificEpithet + scientificNameAuthorship)
Type	string
Format	default

taxonRank

Title (Label)	Taxon Rank
Namespace	dwc
Table:	Identification
IRI	http://rs.tdwg.org/dwc/terms/taxonRank
Description	A taxonomic rank of the most specific name in a dwc:scientificName.
Examples	`subspecies` `varietas` `forma` `species` `genus` `nothogenus` `nothospecies` `nothosubspecies`
Type	string
Format	default

taxonRemarks

Title (Label)	Taxon Remarks
Namespace	dwc
Table:	Identification
IRI	http://rs.tdwg.org/dwc/terms/taxonRemarks
Description	Comments or notes about a dwc:Taxon.
Examples	`This name is a misspelling in common use.`
Type	string
Format	default

feedbackURL

Title (Label)	Feedback URL
Namespace	dwc
Table:	Identification
IRI	http://rs.tdwg.org/dwc/terms/feedbackURL
Comments	A uniform resource locator (URL) that points to a webpage on which a form may be submitted to gather feedback about the record.
Type	string
Format	default

IdentificationTaxon

Identifier: http://rs.tdwg.org/dwc/dwc-dp/identification-taxon

Description: A construct of components and positions of dwc:scientificNames in a dwc:Identification.

Relationships to Other Tables

Field	Target Table	Target Field	Required
identificationID	identification	identificationID	Yes

identificationID

Title (Label)	Identification ID
Namespace	dwc
Table:	IdentificationTaxon
IRI	http://rs.tdwg.org/dwc/terms/identificationID
Description	An identifier for a dwc:Identification.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

taxonID

Title (Label)	Taxon ID
Namespace	dwc
Table:	IdentificationTaxon
IRI	http://rs.tdwg.org/dwc/terms/taxonID
Description	An identifier for a dwc:Taxon.
Comments	In DwC-DP, the taxonID is always an external link to a taxon record. As such, if present, it should be a resolvable globally unique identifier. See the Identifiers section of https://github.com/CatalogueOfLife/coldp/blob/master/README.md.
Examples	`col:6W3C4` `worms:212808` `ipni:320035-2`
Type	string
Format	default

taxonSortOrder

Title (Label)	Taxon Sort Order
Namespace	dwcdp
Table:	IdentificationTaxon
Description	A numerical position of a dwc:Taxon in a taxonFormula.
Examples	`1` `2` `3`
Type	integer
Constraints	{'required': False, 'minimum': 1}
Format	default

higherClassificationName

Title (Label)	Higher Classification Name
Namespace	dwcdp
Table:	IdentificationTaxon
Description	A full scientific name at a higher rank than the taxonRank of dwc:scientificName.
Comments	A higherClassificationName must have a corresponding higherClassificationRank.
Examples	`Animalia` (higherClassificationName) with `kingdom` (higherClassificationRank) `Laphriinae` (higherClassificationName) with `subfamily` (higherClassificationRank)
Type	string
Format	default

higherClassificationRank

Title (Label)	Higher Classification Rank
Namespace	dwcdp
Table:	IdentificationTaxon
Description	A taxonomic rank of the higherClassificationName.
Comments	A higherClassificationRank must have a corresponding higherClassificationName.
Examples	`Acanthaceae` (higherClassificationName) with `family` (higherClassificationRank) `Pyrenomycetes` (higherClassificationName) with `class` (higherClassificationRank
Type	string
Format	default

scientificName

Title (Label)	Scientific Name
Namespace	dwc
Table:	IdentificationTaxon
IRI	http://rs.tdwg.org/dwc/terms/scientificName
Description	A full scientific name, with authorship and date information if known. When forming part of a dwc:Identification, this should be the name in lowest level taxonomic rank that can be determined. This term should not contain identification qualifications, which should instead be supplied in dwc:verbatimIdentification.
Examples	`Coleoptera` (order) `Vespertilionidae` (family) `Manis` (genus) `Ctenomys sociabilis` (genus + specificEpithet) `Ambystoma tigrinum diaboli` (genus + specificEpithet + infraspecificEpithet) `Roptrocerus typographi (Györfi, 1952)` (genus + specificEpithet + scientificNameAuthorship) `Quercus agrifolia var. oxyadenia (Torr.) J.T. Howell` (genus + specificEpithet + taxonRank + infraspecificEpithet + scientificNameAuthorship)
Type	string
Format	default

taxonRank

Title (Label)	Taxon Rank
Namespace	dwc
Table:	IdentificationTaxon
IRI	http://rs.tdwg.org/dwc/terms/taxonRank
Description	A taxonomic rank of the most specific name in a dwc:scientificName.
Examples	`subspecies` `varietas` `forma` `species` `genus` `nothogenus` `nothospecies` `nothosubspecies`
Type	string
Format	default

taxonRemarks

Title (Label)	Taxon Remarks
Namespace	dwc
Table:	IdentificationTaxon
IRI	http://rs.tdwg.org/dwc/terms/taxonRemarks
Description	Comments or notes about a dwc:Taxon.
Examples	`This name is a misspelling in common use.`
Type	string
Format	default

Material

Identifier: http://rs.tdwg.org/dwc/dwc-dp/material

Description: An entity that can be identified, exist for some period of time, and consist in whole or in part of physical matter while it exists.

Comments: The term is defined at the most general level to admit descriptions of any subtype of material entity within the scope of Darwin Core. In particular, any kind of material sample, preserved specimen, fossil, or exemplar from living collections is intended to be subsumed under this term.

Examples:

`the entire contents of a trawl`

`a subset of the contents of a trawl`

`the body of a fish`

`the stomach contents of a fish`

`a rock containing fossils`

`a fossil within a rock`

`an herbarium sheet with its attached plant specimen`

`a flower on a plant specimen`

`a pollen grain`

`a specific water sample`

`an isolated molecule of DNA`

Relationships to Other Tables

Field	Target Table	Target Field	Required
eventID	event	eventID	Yes
institutionID	agent	agentID	No
ownerInstitutionID	agent	agentID	No
collectedByID	agent	agentID	No
evidenceForOccurrenceID	occurrence	occurrenceID	No
derivedFromMaterialEntityID	material	materialEntityID	No
derivationEventID	event	eventID	No
isPartOfMaterialEntityID	material	materialEntityID	No
identifiedByID	agent	agentID	No

materialEntityID

Title (Label)	Material Entity ID
Namespace	dwc
Table:	Material
IRI	http://rs.tdwg.org/dwc/terms/materialEntityID
Description	An identifier for a dwc:MaterialEntity.
Comments	Values of dwc:materialEntityID are intended to uniquely and persistently identify a particular dwc:MaterialEntity within some context. Examples of context include a particular sample collection, an organization, or the worldwide scale. Recommended best practice is to use a persistent, globally unique identifier. The identifier is bound to a physical object (a dwc:MaterialEntity) as opposed to a particular digital record (representation) of that physical object.
Type	string
Constraints	{'required': True, 'unique': True}
Format	default

digitalSpecimenID

Title (Label)	Digital Specimen ID
Namespace	dwc
Table:	Material
IRI	http://rs.tdwg.org/dwc/terms/digitalSpecimenID
Description	An identifier for a particular instance of a Digital Specimen.
Comments	A Digital Specimen as defined in https://doi.org/10.3897/rio.7.e67379. A dwc:digitalSpecimenID is intended to uniquely and persistently identify a Digital Specimen. Recommended best practice is to use a DOI with machine readable metadata in the DOI record that uses a community agreed metadata profile (also known as FDO profile) for a Digital Specimen. For an example see: https://doi.org/10.3535/N75-CR4-0SM?noredirect. The identifier is for a digital information artifact (the Digital Specimen) as opposed to an identifier for a specific instance of a dwc:MaterialEntity.
Examples	`https://doi.org/10.3535/M42-Z4P-DRD` `https://doi.org/10.3535/M42-Z4P-DRD?urlappend=/1` `doi:10.3535/M42-Z4P-DRD`
Type	string
Format	default

eventID

Title (Label)	Event ID
Namespace	dwc
Table:	Material
IRI	http://rs.tdwg.org/dwc/terms/eventID
Description	An identifier for a dwc:Event.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

materialCategory

Title (Label)	Material Category
Namespace	dwcdp
Table:	Material
Description	A broad category that best matches the nature of a dwc:MaterialEntity.
Comments	Recommended best practice is to use a limited, tightly controlled vocabulary.
Examples	`preserved` `living` `fossilized` `tissue` `DNA extract` `non-biological` `human-made`
Type	string
Format	default

discipline

Title (Label)	Discipline
Namespace	dwc
Table:	Material
IRI	http://rs.tdwg.org/dwc/terms/discipline
Description	The primary branch or branches of knowledge represented by the dwc:MaterialEntity.
Comments	This term can be used to classify records according to branches of knowledge. Recommended best practice is to use a controlled vocabulary and to separate the values in a list with space vertical bar space ( \| ). It is also recommended to use this field to describe specimenType in MIDS.
Examples	`Botany ` `Botany \| Virology \| Taxonomy`
Type	string
Format	default

materialEntityType

Title (Label)	Material Entity Type
Namespace	dwcdp
Table:	Material
Description	A narrow category that best matches the nature of a dwc:MaterialEntity.
Comments	Recommended best practice is to use a controlled vocabulary.
Examples	`whole organism` `heart` `liver tissue sample` `fossil` `germplasm` `skull` `cast` `3D printed model` `printed photograph`
Type	string
Format	default

institutionCode

Title (Label)	Institution Code
Namespace	dwc
Table:	Material
IRI	http://rs.tdwg.org/dwc/terms/institutionCode
Description	A name (or acronym) in use by an institution.
Examples	`MVZ` `FMNH` `CLO` `UCMP`
Type	string
Format	default

institutionID

Title (Label)	Institution ID
Namespace	dwc
Table:	Material
IRI	http://rs.tdwg.org/dwc/terms/institutionID
Description	An identifier for an institution.
Comments	For physical specimens, the recommended best practice is to use a globally unique and resolvable identifier from a collections registry such as the Research Organization Registry (ROR) or the Global Registry of Scientific Collections (https://scientific-collections.gbif.org/).
Examples	`https://ror.org/015hz7p22` `http://grscicoll.org/institution/museum-southwestern-biology` `https://scientific-collections.gbif.org/institution/e3d4dcc4-81e2-444c-8a5c-41d1044b5381`
Type	string
Format	default

ownerInstitutionCode

Title (Label)	Owner Institution Code
Namespace	dwc
Table:	Material
IRI	http://rs.tdwg.org/dwc/terms/ownerInstitutionCode
Description	A name (or acronym) in use by an institution having ownership of a dwc:MaterialEntity.
Examples	`NPS` `APN` `InBio`
Type	string
Format	default

ownerInstitutionID

Title (Label)	Owner Institution ID
Namespace	dwcdp
Table:	Material
Description	An identifier for an institution that owns a dwc:MaterialEntity.
Comments	For physical specimens, the recommended best practice is to use a globally unique and resolvable identifier from a collections registry such as the Research Organization Registry (ROR) or the Global Registry of Scientific Collections (https://scientific-collections.gbif.org/).
Examples	`https://ror.org/015hz7p22` `http://grscicoll.org/institution/museum-southwestern-biology` `https://scientific-collections.gbif.org/institution/e3d4dcc4-81e2-444c-8a5c-41d1044b5381`
Type	string
Format	default

collectionCode

Title (Label)	Collection Code
Namespace	dwc
Table:	Material
IRI	http://rs.tdwg.org/dwc/terms/collectionCode
Description	A name, acronym, coden, or initialism identifying a Collection.
Examples	`Mammals` `Hildebrandt` `EBIRD` `VP`
Type	string
Format	default

collectionID

Title (Label)	Collection ID
Namespace	dwc
Table:	Material
IRI	http://rs.tdwg.org/dwc/terms/collectionID
Description	An identifier for a Collection.
Comments	For physical specimens, the recommended best practice is to use a globally unique and resolvable identifier from a collections registry such as the Global Registry of Scientific Collections (https://scientific-collections.gbif.org/).
Examples	`https://scientific-collections.gbif.org/collection/fbd3ed74-5a21-4e01-b86a-33d36f032d9c`
Type	string
Format	default

catalogNumber

Title (Label)	Catalog Number
Namespace	dwc
Table:	Material
IRI	http://rs.tdwg.org/dwc/terms/catalogNumber
Description	An identifier (preferably unique) for a dwc:MaterialEntity within a Collection.
Examples	`145732` `145732a` `2008.1334` `R-4313`
Type	string
Format	default

otherCatalogNumbers

Title (Label)	Other Catalog Numbers
Namespace	dwc
Table:	Material
IRI	http://rs.tdwg.org/dwc/terms/otherCatalogNumbers
Description	A list (concatenated and separated) of previous or alternate fully qualified catalog numbers or other human-used identifiers for the same dwc:MaterialEntity, whether in the current or any other data set or collection.
Comments	Recommended best practice is to separate the values in a list with space vertical bar space (` \| `).
Examples	`FMNH:Mammal:1234` `NPS YELLO6778 \| MBG 33424`
Type	string
Format	default

collectedBy

Title (Label)	Collected By
Namespace	dwc
Table:	Material
IRI	http://rs.tdwg.org/dwc/terms/recordedBy
Description	A list (concatenated and separated) of names of Agents responsible for collecting a dwc:MaterialEntity.
Comments	Recommended best practice is to separate the values in a list with space vertical bar space ( \| ).
Examples	`José E. Crespo` `Oliver P. Pearson \| Anita K. Pearson` `FMNH`
Type	string
Format	default

collectedByID

Title (Label)	Collected By ID
Namespace	dwc
Table:	Material
IRI	http://rs.tdwg.org/dwc/terms/recordedByID
Description	An identifier for the Agent responsible for collecting a dwc:MaterialEntity.
Comments	Recommended best practice is to use a globally unique identifier.
Examples	`https://orcid.org/0000-0002-1825-0097`, `https://ror.org/00mh9zx15`
Type	string
Format	default

objectQuantity

Title (Label)	Object Quantity
Namespace	dwc
Table:	Material
IRI	http://rs.tdwg.org/dwc/terms/individualCount
Description	A number or enumeration value for the quantity of differentiable dwc:MaterialEntities comprising this dwc:MaterialEntity.
Comments	An objectQuantity must have a corresponding objectQuantityType.
Examples	`27` (objectQuantity) with `individuals` (objectQuantityType) `many` (objectQuantity) with `individuals` (objectQuantityType)
Type	string
Format	default

objectQuantityType

Title (Label)	Object Quantity Type
Namespace	dwc
Table:	Material
IRI	http://rs.tdwg.org/dwc/terms/individualCount
Description	A number or enumeration value for the quantity of differentiable dwc:MaterialEntities comprising this dwc:MaterialEntity.
Comments	An objectQuantity must have a corresponding objectQuantityType.
Examples	`27` (objectQuantity) with `individuals` (objectQuantityType) `many` (objectQuantity) with `individuals` (objectQuantityType)
Type	string
Format	default

recordNumber

Title (Label)	Record Number
Namespace	dwc
Table:	Material
IRI	http://rs.tdwg.org/dwc/terms/recordNumber
Description	An identifier given to a dwc:MaterialEntity at the time it was recorded.
Comments	Often serves as a link between field notes and a dwc:MaterialEntity, such as a specimen collector's number.
Examples	`OPP 7101`
Type	string
Format	default

preparations

Title (Label)	Preparations
Namespace	dwc
Table:	Material
IRI	http://rs.tdwg.org/dwc/terms/preparations
Description	A list (concatenated and separated) of preparations and preservation methods for a dwc:MaterialEntity.
Comments	Recommended best practice is to separate the values in a list with space vertical bar space (` \| `).
Examples	`fossil` `cast` `photograph` `DNA extract` `skin \| skull \| skeleton` `whole animal (EtOH) \| tissue (EDTA)`
Type	string
Format	default

disposition

Title (Label)	Disposition
Namespace	dwc
Table:	Material
IRI	http://rs.tdwg.org/dwc/terms/disposition
Description	A current state of a dwc:MaterialEntity with respect to where it can be found.
Comments	Recommended best practice is to use a controlled vocabulary.
Examples	`in collection` `missing` `voucher elsewhere` `duplicates elsewhere`
Type	string
Format	default

verbatimLabel

Title (Label)	Verbatim Label
Namespace	dwc
Table:	Material
IRI	http://rs.tdwg.org/dwc/terms/verbatimLabel
Description	The content of this term should include no embellishments, prefixes, headers or other additions made to the text. Abbreviations must not be expanded and supposed misspellings must not be corrected. Lines or breakpoints between blocks of text that could be verified by seeing the original labels or images of them may be used. Examples of material entities include preserved specimens, fossil specimens, and material samples. Best practice is to use UTF-8 for all characters. Best practice is to add comment “verbatimLabel derived from human transcription” in dwc:occurrenceRemarks.
Comments	Examples can be found at https://dwc.tdwg.org/examples/verbatimLabel.
Type	string
Format	default

associatedSequences

Title (Label)	Associated Sequences
Namespace	dwc
Table:	Material
IRI	http://rs.tdwg.org/dwc/terms/associatedSequences
Description	A list (concatenated and separated) of identifiers (publication, global unique identifier, URI) of genetic sequence information associated with a dwc:MaterialEntity.
Examples	`http://www.ncbi.nlm.nih.gov/nuccore/U34853.1` `http://www.ncbi.nlm.nih.gov/nuccore/GU328060 \| http://www.ncbi.nlm.nih.gov/nuccore/AF326093`
Type	string
Format	default

materialReferences

Title (Label)	Material References
Namespace	dwc
Table:	Material
IRI	http://rs.tdwg.org/dwc/terms/associatedReferences
Description	A list (concatenated and separated) of identifiers (publication, bibliographic reference, global unique identifier, URI) of literature associated with a dwc:MaterialEntity.
Comments	Recommended best practice is to separate the values in a list with space vertical bar space (` \| `).
Examples	`Christopher J. Conroy, Jennifer L. Neuwald. 2008. Phylogeographic study of the California vole, Microtus californicus Journal of Mammalogy, 89(3):755-767.` `Steven R. Hoofer and Ronald A. Van Den Bussche. 2001. Phylogenetic Relationships of Plecotine Bats and Allies Based on Mitochondrial Ribosomal Sequences. Journal of Mammalogy 82(1):131-137. \| Walker, Faith M., Jeffrey T. Foster, Kevin P. Drees, Carol L. Chambers. 2014. Spotted bat (Euderma maculatum) microsatellite discovery using illumina sequencing. Conservation Genetics Resources.`
Type	string
Format	default

informationWithheld

Title (Label)	Information Withheld
Namespace	dwc
Table:	Material
IRI	http://rs.tdwg.org/dwc/terms/informationWithheld
Description	Additional information that exists, but that has not been shared in the given record.
Examples	`location information not given for endangered species` `collector identities withheld \| ask about tissue samples`
Type	string
Format	default

dataGeneralizations

Title (Label)	Data Generalizations
Namespace	dwc
Table:	Material
IRI	http://rs.tdwg.org/dwc/terms/dataGeneralizations
Description	Actions taken to make the shared data less specific or complete than in its original form. Suggests that alternative data of higher quality may be available on request.
Examples	`coordinates generalized from original GPS coordinates to the nearest half degree grid cell`
Type	string
Format	default

materialEntityRemarks

Title (Label)	Material Entity Remarks
Namespace	dwc
Table:	Material
IRI	http://rs.tdwg.org/dwc/terms/materialEntityRemarks
Description	Comments or notes about a dwc:MaterialEntity.
Examples	`found in association with charred remains` `some original fragments missing`
Type	string
Format	default

evidenceForOccurrenceID

Title (Label)	Evidence For Occurrence ID
Namespace	dwcdp
Table:	Material
IRI	http://rs.tdwg.org/dwc/terms/occurrenceID
Description	An identifier for a dwc:Occurrence for which a dwc:MaterialEntity provides evidence.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Format	default

derivedFromMaterialEntityID

Title (Label)	Derived From Material Entity ID
Namespace	dwcdp
Table:	Material
Description	An identifier for a dwc:MaterialEntity from which this dwc:MaterialEntity was derived.
Comments	This dwc:MaterialEntity is separate from a dwc:MaterialEntity from which it was derived (cf. isPartOfMaterialEntityID). Recommended best practice is to use a globally unique identifier.
Type	string
Format	default

derivationEventID

Title (Label)	Derivation Event ID
Namespace	dwcdp
Table:	Material
IRI	http://rs.tdwg.org/dwc/terms/materialEntityID
Description	An identifier for a dwc:Event during which a dwc:MaterialEntity was derived from another dwc:MaterialEntity.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Format	default

derivationType

Title (Label)	Derivation Type
Namespace	dwcdp
Table:	Material
Description	A category that best matches the nature of the derivation of a dwc:MaterialEntity from a dwc:MaterialEntity pointed to by derivedFromMaterialEntityID.
Comments	Recommended best practice is to use a controlled vocabulary.
Examples	`sampledFrom` `included`
Type	string
Format	default

isPartOfMaterialEntityID

Title (Label)	Is Part Of Material Entity ID
Namespace	dwcdp
Table:	Material
Description	An identifier for a dwc:MaterialEntity of which this dwc:MaterialEntity is a part.
Comments	This dwc:MaterialEntity was not taken from a dwc:MaterialEntity of which it is a part. Recommended best practice is to use a globally unique identifier.
Type	string
Format	default

verbatimIdentification

Title (Label)	Verbatim Identification
Namespace	dwc
Table:	Material
IRI	http://rs.tdwg.org/dwc/terms/verbatimIdentification
Description	A string representing a taxonomic identification as it appeared in the original record.
Examples	`Ctenomys sociabilis` `social tuco-tuco` `Peromyscus sp.` `Ministrymon sp. nov. 1` `Anser anser × Branta canadensis` `Pachyporidae?`
Type	string
Format	default

taxonFormula

Title (Label)	Taxon Formula
Namespace	dwcdp
Table:	Material
Description	A string representing the pattern to use to construct a dwc:Identification from dwc:Taxon names and identification qualifiers.
Comments	Recommended best practice is to use a controlled vocabulary such as https://arctos.database.museum/info/ctDocumentation.cfm?table=cttaxa_formula.
Examples	`A` `A ?` `A or B` `A and B` `A x B` `A cf.` `A aff.`
Type	string
Default	A
Format	default

typeStatus

Title (Label)	Type Status
Namespace	dwc
Table:	Material
IRI	http://rs.tdwg.org/dwc/terms/typeStatus
Description	A list (concatenated and separated) of nomenclatural types (type status, typified scientific name, publication) applied to the subject.
Comments	Recommended best practice is to separate the values in a list with space vertical bar space ( \| ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`holotype of Ctenomys sociabilis. Pearson O. P., and M. I. Christie. 1985. Historia Natural, 5(37):388` `holotype of Pinus abies \| holotype of Picea abies`
Type	string
Format	default

typeDesignationType

Title (Label)	typeDesignationType
Namespace	gbif
Table:	Material
IRI	http://rs.gbif.org/terms/1.0/typeDesignationType
Description	A category that best matches the nature of a type designation.
Comments	From https://rs.gbif.org/extension/gbif/1.0/typesandspecimen.xml.
Examples	`monotypy` `original designation` `tautonomy`
Type	string
Format	default

typifiedName

Title (Label)	Typified Name
Namespace	tcs
Table:	Material
IRI	http://rs.tdwg.org/tcs/terms/typifiedName
Description	A scientific name for which a specimen or other name is the type.
Comments	From https://rs.gbif.org/extension/gbif/1.0/typesandspecimen.xml.
Examples	`monotypy` `original designation` `tautonomy`
Type	string
Format	default

identifiedBy

Title (Label)	Identified By
Namespace	dwc
Table:	Material
IRI	http://rs.tdwg.org/dwc/terms/identifiedBy
Description	A list (concatenated and separated) of names of Agents responsible for making a taxonomic determination of a dwc:Organism.
Comments	When used in the context of a Survey, the subject consists of all of the dwc:Identifications related to the Event. Recommended best practice is to separate the values in a list with space vertical bar space ( \| ).
Examples	`James L. Patton` `Theodore Pappenfuss \| Robert Macey`
Type	string
Format	default

identifiedByID

Title (Label)	Identified By ID
Namespace	dwc
Table:	Material
IRI	http://rs.tdwg.org/dwc/terms/identifiedByID
Description	An identifier for the Agent responsible for making a taxonomic determination of a dwc:Organism.
Comments	When used in the context of a Survey, the subject consists of all of the dwc:Identifications related to the Survey. Recommended best practice is to provide a single identifier that disambiguates the details of the identifying agent. If a list is used, the order of the identifiers on the list should not be assumed to convey any semantics. Recommended best practice is to separate the values in a list with space vertical bar space (` \| `).
Examples	`https://orcid.org/0000-0002-1825-0097`
Type	string
Format	default

dateIdentified

Title (Label)	Date Identified
Namespace	dwc
Table:	Material
IRI	http://rs.tdwg.org/dwc/terms/dateIdentified
Description	A date on which the subject was determined as representing a dwc:Taxon.
Comments	Recommended best practice is to use a date that conforms to ISO 8601-1:2019.
Examples	`2023-05-04`
Type	string
Format	default

identificationReferences

Title (Label)	Identification References
Namespace	dwc
Table:	Material
IRI	http://rs.tdwg.org/dwc/terms/identificationReferences
Description	A list (concatenated and separated) of identifiers for References (publication, bibliographic reference, global unique identifier, URI, metabarcoding reference database) used in a dwc:Identification.
Comments	When used in the context of a Survey, the subject consists of all of the dwc:Identifications related to the Survey. Recommended best practice is to separate the values in a list with space vertical bar space (` \| `).
Examples	`Aves del Noroeste Patagonico. Christie et al. 2004.` `Stebbins, R. Field Guide to Western Reptiles and Amphibians. 3rd Edition. 2003. \| Irschick, D.J. and Shaffer, H.B. (1997). The polytypic species revisited: Morphological differentiation among tiger salamanders (Ambystoma tigrinum) (Amphibia: Caudata). Herpetologica, 53(1), 30-49.`
Type	string
Format	default

identificationVerificationStatus

Title (Label)	Identification Verification Status
Namespace	dwc
Table:	Material
IRI	http://rs.tdwg.org/dwc/terms/identificationVerificationStatus
Description	A categorical indicator of the extent to which a taxonomic determination has been verified to be correct.
Comments	Recommended best practice is to use a controlled vocabulary such as that used in HISPID and ABCD.
Examples	`0` ('unverified' in HISPID/ABCD)
Type	string
Format	default

identificationRemarks

Title (Label)	Identification Remarks
Namespace	dwc
Table:	Material
IRI	http://rs.tdwg.org/dwc/terms/identificationRemarks
Description	Comments or notes about a dwc:Identification.
Examples	`Distinguished between Anthus correndera and Anthus hellmayri based on the comparative lengths of the uñas.`
Type	string
Format	default

taxonID

Title (Label)	Taxon ID
Namespace	dwc
Table:	Material
IRI	http://rs.tdwg.org/dwc/terms/taxonID
Description	An identifier for a dwc:Taxon.
Comments	In DwC-DP, the taxonID is always an external link to a taxon record. As such, if present, it should be a resolvable globally unique identifier. See the Identifiers section of https://github.com/CatalogueOfLife/coldp/blob/master/README.md.
Examples	`col:6W3C4` `worms:212808` `ipni:320035-2`
Type	string
Format	default

higherClassificationName

Title (Label)	Higher Classification Name
Namespace	dwcdp
Table:	Material
Description	A full scientific name at a higher rank than the taxonRank of dwc:scientificName.
Comments	A higherClassificationName must have a corresponding higherClassificationRank.
Examples	`Animalia` (higherClassificationName) with `kingdom` (higherClassificationRank) `Laphriinae` (higherClassificationName) with `subfamily` (higherClassificationRank)
Type	string
Format	default

higherClassificationRank

Title (Label)	Higher Classification Rank
Namespace	dwcdp
Table:	Material
Description	A taxonomic rank of the higherClassificationName.
Comments	A higherClassificationRank must have a corresponding higherClassificationName.
Examples	`Acanthaceae` (higherClassificationName) with `family` (higherClassificationRank) `Pyrenomycetes` (higherClassificationName) with `class` (higherClassificationRank
Type	string
Format	default

scientificName

Title (Label)	Scientific Name
Namespace	dwc
Table:	Material
IRI	http://rs.tdwg.org/dwc/terms/scientificName
Description	A full scientific name, with authorship and date information if known. When forming part of a dwc:Identification, this should be the name in lowest level taxonomic rank that can be determined. This term should not contain identification qualifications, which should instead be supplied in dwc:verbatimIdentification.
Examples	`Coleoptera` (order) `Vespertilionidae` (family) `Manis` (genus) `Ctenomys sociabilis` (genus + specificEpithet) `Ambystoma tigrinum diaboli` (genus + specificEpithet + infraspecificEpithet) `Roptrocerus typographi (Györfi, 1952)` (genus + specificEpithet + scientificNameAuthorship) `Quercus agrifolia var. oxyadenia (Torr.) J.T. Howell` (genus + specificEpithet + taxonRank + infraspecificEpithet + scientificNameAuthorship)
Type	string
Format	default

taxonRank

Title (Label)	Taxon Rank
Namespace	dwc
Table:	Material
IRI	http://rs.tdwg.org/dwc/terms/taxonRank
Description	A taxonomic rank of the most specific name in a dwc:scientificName.
Examples	`subspecies` `varietas` `forma` `species` `genus` `nothogenus` `nothospecies` `nothosubspecies`
Type	string
Format	default

taxonRemarks

Title (Label)	Taxon Remarks
Namespace	dwc
Table:	Material
IRI	http://rs.tdwg.org/dwc/terms/taxonRemarks
Description	Comments or notes about a dwc:Taxon.
Examples	`This name is a misspelling in common use.`
Type	string
Format	default

feedbackURL

Title (Label)	Feedback URL
Namespace	dwc
Table:	Material
IRI	http://rs.tdwg.org/dwc/terms/feedbackURL
Comments	A uniform resource locator (URL) that points to a webpage on which a form may be submitted to gather feedback about the record.
Type	string
Format	default

NucleotideAnalysis

Identifier: http://rs.tdwg.org/dwc/dwc-dp/nucleotide-analysis

Description: A link between a NucleotideSequence and a dwc:Event and a dwc:MaterialEntity from which it was derived, using a specified Protocol.

Relationships to Other Tables

Field	Target Table	Target Field	Required
eventID	event	eventID	Yes
molecularProtocolID	molecular-protocol	molecularProtocolID	Yes
nucleotideSequenceID	nucleotide-sequence	nucleotideSequenceID	No
materialEntityID	material	materialEntityID	No

nucleotideAnalysisID

Title (Label)	Nucleotide Analysis ID
Namespace	dwcdp
Table:	NucleotideAnalysis
Description	An identifier for a NucleotideAnalysis.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': True}
Format	default

eventID

Title (Label)	Event ID
Namespace	dwcdp
Table:	NucleotideAnalysis
Description	An identifier for a dwc:Event.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True}
Format	default

molecularProtocolID

Title (Label)	Molecular Protocol ID
Namespace	dwcdp
Table:	NucleotideAnalysis
Description	An identifier for a MolecularProtocol.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True}
Format	default

nucleotideSequenceID

Title (Label)	Nucleotide Sequence ID
Namespace	dwcdp
Table:	NucleotideAnalysis
Description	An identifier for a NucleotideSequence.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Format	default

materialEntityID

Title (Label)	Material Entity ID
Namespace	dwcdp
Table:	NucleotideAnalysis
Description	An identifier for a dwc:MaterialEntity.
Comments	Values of dwc:materialEntityID are intended to uniquely and persistently identify a particular dwc:MaterialEntity within some context. Examples of context include a particular sample collection, an organization, or the worldwide scale. Recommended best practice is to use a persistent, globally unique identifier. The identifier is bound to a physical object (a dwc:MaterialEntity) as opposed to a particular digital record (representation) of that physical object.
Type	string
Format	default

readCount

Title (Label)	Read Count
Namespace	dwcdp
Table:	NucleotideAnalysis
Description	A number of reads for a NucleotideSequence in a NucleotideAnalysis.
Type	integer
Format	default

totalReadCount

Title (Label)	Total Read Count
Namespace	dwcdp
Table:	NucleotideAnalysis
Description	A total number of reads in a NucleotideAnalysis.
Type	integer
Format	default

MolecularProtocol

Identifier: http://rs.tdwg.org/dwc/dwc-dp/molecular-protocol

Description: A protocol used to derive and identify a nucleotide sequence from a dwc:MaterialEntity.

Examples:

`a standard DNA barcoding workflow using Sanger sequencing`

`a shotgun metagenomics pipeline for microbial community profiling`

`a high-throughput amplicon sequencing protocol targeting 16S rRNA`

Relationships to Other Tables

Field	Target Table	Target Field	Required
source_mat_id	material	materialEntityID	No

molecularProtocolID

Title (Label)	Molecular Protocol ID
Namespace	dwcdp
Table:	MolecularProtocol
Description	An identifier for a MolecularProtocol.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': True}
Format	default

assayType

Title (Label)	Assay Type
Namespace	dwcdp
Table:	MolecularProtocol
Description	A method used in the study to detect taxon/taxa of interest in the sample.
Comments	Recommended best practice is to use a controlled vocabulary.
Examples	`targeted` `metabarcoding` `sanger sequencing` `genome skimming` `whole genome sequencing` `metagenomic` `other`
Type	string
Format	default

samp_name

Title (Label)	samp_name
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0001107
Description	Sample Name is a name that you choose for the sample. It can have any format, but we suggest that you make it concise, unique and consistent within your lab, and as informative as possible. Every Sample Name from a single Submitter must be unique.
Type	string
Format	default

project_name

Title (Label)	project_name
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000092
Description	Name of the project within which the sequencing was organized.
Examples	`Forest soil metagenome`
Type	string
Format	default

experimental_factor

Title (Label)	experimental_factor
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000008
Description	Experimental factors are essentially the variable aspects of an experiment design which can be used to describe an experiment, or set of experiments, in an increasingly detailed manner. This field accepts ontology terms from Experimental Factor Ontology (EFO) and/or Ontology for Biomedical Investigations (OBI). For a browser of EFO (v 2.95) terms, please see http://purl.bioontology.org/ontology/EFO; for a browser of OBI (v 2018-02-12) terms please see http://purl.bioontology.org/ontology/OBI.
Examples	`time series design [EFO:EFO_0001779]`
Type	string
Format	default

samp_taxon_id

Title (Label)	samp_taxon_id
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0001320
Description	NCBI taxon id of the sample. Maybe be a single taxon or mixed taxa sample. Use "synthetic metagenome" for mock community/positive controls, or "blank sample" for negative controls.
Examples	`Gut Metagenome [NCBITaxon:749906]`
Type	string
Format	default

neg_cont_type

Title (Label)	neg_cont_type
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0001321
Description	The substance or equipment used as a negative control in an investigation.
Type	string
Format	default

pos_cont_type

Title (Label)	pos_cont_type
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0001322
Description	The substance, mixture, product, or apparatus used to verify that a process which is part of an investigation delivers a true positive.
Type	string
Format	default

env_broad_scale

Title (Label)	env_broad_scale
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000012
Description	In this field, report which major environmental system your sample or specimen came from. The systems identified should have a coarse spatial grain, to provide the general environmental context of where the sampling was done (e.g. were you in the desert or a rainforest?). We recommend using subclasses of ENVO’s biome class: http://purl.obolibrary.org/obo/ENVO_00000428. Format (one term): termLabel [termID], Format (multiple terms): termLabel [termID]\|termLabel [termID]\|termLabel [termID]. Example: Annotating a water sample from the photic zone in middle of the Atlantic Ocean, consider: oceanic epipelagic zone biome [ENVO:01000033]. Example: Annotating a sample from the Amazon rainforest consider: tropical moist broadleaf forest biome [ENVO:01000228]. If needed, request new terms on the ENVO tracker, identified here: http://www.obofoundry.org/ontology/envo.html.
Examples	`forest biome [ENVO:01000174]`
Type	string
Format	default

env_local_scale

Title (Label)	env_local_scale
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000013
Description	In this field, report the entity or entities which are in your sample or specimen’s local vicinity and which you believe have significant causal influences on your sample or specimen. Please use terms that are present in ENVO and which are of smaller spatial grain than your entry for env_broad_scale. Format (one term): termLabel [termID]; Format (multiple terms): termLabel [termID]\|termLabel [termID]\|termLabel [termID]. Example: Annotating a pooled sample taken from various vegetation layers in a forest consider: canopy [ENVO:00000047]\|herb and fern layer [ENVO:01000337]\|litter layer [ENVO:01000338]\|understory [01000335]\|shrub layer [ENVO:01000336]. If needed, request new terms on the ENVO tracker, identified here: http://www.obofoundry.org/ontology/envo.html.
Examples	`litter layer [ENVO:01000338]`
Type	string
Format	default

env_medium

Title (Label)	env_medium
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000014
Description	In this field, report which environmental material or materials (pipe separated) immediately surrounded your sample or specimen prior to sampling, using one or more subclasses of ENVO’s environmental material class: http://purl.obolibrary.org/obo/ENVO_00010483. Format (one term): termLabel [termID]; Format (multiple terms): termLabel [termID]\|termLabel [termID]\|termLabel [termID]. Example: Annotating a fish swimming in the upper 100 m of the Atlantic Ocean, consider: ocean water [ENVO:00002151]. Example: Annotating a duck on a pond consider: pond water [ENVO:00002228]\|air ENVO_00002005. If needed, request new terms on the ENVO tracker, identified here: http://www.obofoundry.org/ontology/envo.html.
Examples	`soil [ENVO:00001998]`
Type	string
Format	default

subspecf_gen_lin

Title (Label)	subspecf_gen_lin
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000020
Description	This should provide further information about the genetic distinctness of the sequenced organism by recording additional information e.g. serovar, serotype, biotype, ecotype, or any relevant genetic typing schemes like Group I plasmid. It can also contain alternative taxonomic information. It should contain both the lineage name, and the lineage rank, i.e. biovar:abc123.
Examples	`serovar:Newport`
Type	string
Format	default

ploidy

Title (Label)	ploidy
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000021
Description	The ploidy level of the genome (e.g. allopolyploid, haploid, diploid, triploid, tetraploid). It has implications for the downstream study of duplicated gene and regions of the genomes (and perhaps for difficulties in assembly). For terms, please select terms listed under class ploidy (PATO:001374) of Phenotypic Quality Ontology (PATO), and for a browser of PATO (v 2018-03-27) please refer to http://purl.bioontology.org/ontology/PATO.
Examples	`allopolyploidy [PATO:0001379]`
Type	string
Format	default

num_replicons

Title (Label)	num_replicons
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000022
Description	Reports the number of replicons in a nuclear genome of eukaryotes, in the genome of a bacterium or archaea or the number of segments in a segmented virus. Always applied to the haploid chromosome count of a eukaryote.
Examples	`2`
Type	integer
Format	default

extrachrom_elements

Title (Label)	extrachrom_elements
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000023
Description	Do plasmids exist of significant phenotypic consequence (e.g. ones that determine virulence or antibiotic resistance). Megaplasmids? Other plasmids (borrelia has 15+ plasmids).
Examples	`5`
Type	string
Format	default

estimated_size

Title (Label)	estimated_size
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000024
Description	The estimated size of the genome prior to sequencing. Of particular importance in the sequencing of (eukaryotic) genome which could remain in draft form for a long or unspecified period.
Examples	`300000 bp`
Type	string
Format	default

ref_biomaterial

Title (Label)	ref_biomaterial
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000025
Description	Primary publication if isolated before genome publication; otherwise, primary genome report.
Examples	`doi:10.1016/j.syapm.2018.01.009`
Type	string
Format	default

source_mat_id

Title (Label)	source_mat_id
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000026
Description	A unique identifier assigned to a material sample (as defined by http://rs.tdwg.org/dwc/terms/materialSampleID, and as opposed to a particular digital record of a material sample) used for extracting nucleic acids, and subsequent sequencing. The identifier can refer either to the original material collected or to any derived sub-samples. The INSDC qualifiers /specimen_voucher, /bio_material, or /culture_collection may or may not share the same value as the source_mat_id field. For instance, the /specimen_voucher qualifier and source_mat_id may both contain ´UAM:Herps:14´ , referring to both the specimen voucher and sampled tissue with the same identifier. However, the /culture_collection qualifier may refer to a value from an initial culture (e.g. ATCC:11775) while source_mat_id would refer to an identifier from some derived culture from which the nucleic acids were extracted (e.g. xatc123 or ark:/2154/R2).
Examples	`MPI012345`
Type	string
Format	default

pathogenicity

Title (Label)	pathogenicity
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000027
Description	To what is the entity pathogenic.
Examples	`human` `animal` `plant` `fungi` `bacteria`
Type	string
Format	default

biotic_relationship

Title (Label)	biotic_relationship
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000028
Description	Description of relationship(s) between the subject organism and other organism(s) it is associated with. E.g., parasite on species X; mutualist with species Y. The target organism is the subject of the relationship, and the other organism(s) is the object.
Examples	`free living`
Type	string
Format	default

specific_host

Title (Label)	specific_host
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000029
Description	If there is a host involved, please provide its taxid (or environmental if not actually isolated from the dead or alive host - i.e. a pathogen could be isolated from a swipe of a bench etc) and report whether it is a laboratory or natural host).
Examples	`9606`
Type	string
Format	default

host_spec_range

Title (Label)	host_spec_range
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000030
Description	The NCBI taxonomy identifier of the specific host if it is known.
Examples	`9606`
Type	string
Format	default

host_disease_stat

Title (Label)	host_disease_stat
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000031
Description	List of diseases with which the host has been diagnosed; can include multiple diagnoses. The value of the field depends on host; for humans the terms should be chosen from the DO (Human Disease Ontology) at https://www.disease-ontology.org, non-human host diseases are free text.
Examples	`dead`
Type	string
Format	default

trophic_level

Title (Label)	trophic_level
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000032
Description	Trophic levels are the feeding position in a food chain. Microbes can be a range of producers (e.g. chemolithotroph).
Examples	`heterotroph`
Type	string
Format	default

propagation

Title (Label)	propagation
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000033
Description	This field is specific to different taxa. For phages: lytic/lysogenic, for plasmids: incompatibility group, for eukaryotes: sexual/asexual (Note: there is the strong opinion to name phage propagation obligately lytic or temperate, therefore we also give this choice.
Examples	`lytic`
Type	string
Format	default

encoded_traits

Title (Label)	encoded_traits
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000034
Description	Should include key traits like antibiotic resistance or xenobiotic degradation phenotypes for plasmids, converting genes for phage.
Examples	`beta-lactamase class A`
Type	string
Format	default

rel_to_oxygen

Title (Label)	rel_to_oxygen
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000015
Description	Is this organism an aerobe, anaerobe? Please note that aerobic and anaerobic are valid descriptors for microbial environments.
Examples	`aerobe`
Type	string
Format	default

isol_growth_condt

Title (Label)	isol_growth_condt
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000003
Description	Publication reference in the form of pubmed ID (pmid), digital object identifier (doi) or url for isolation and growth condition specifications of the organism/material.
Examples	`doi:10.1016/j.syapm.2018.01.009`
Type	string
Format	default

samp_collec_device

Title (Label)	samp_collec_device
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000002
Description	The device used to collect an environmental sample. This field accepts terms listed under environmental sampling device (http://purl.obolibrary.org/obo/ENVO). This field also accepts terms listed under specimen collection device (http://purl.obolibrary.org/obo/GENEPIO_0002094).
Examples	`sediment corer` `plankton net` `Niskin bottle` `Van Veen grab` `light trap` `Malaise trap` `Hester-Dendy sampler` `water bottle rosette` `soil auger` `sweep net` `pitfall trap` `air sampler`
Type	string
Format	default

samp_collec_method

Title (Label)	samp_collec_method
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0001225
Description	The method employed for collecting the sample.
Examples	`environmental swab sampling` `biopsy` `niskin bottle` `push core`
Type	string
Format	default

samp_mat_process

Title (Label)	samp_mat_process
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000016
Description	Any processing applied to the sample during or after retrieving the sample from environment. This field accepts OBI, for a browser of OBI (v 2018-02-12) terms please see http://purl.bioontology.org/ontology/OBI.
Examples	`filtering of seawater` `storing samples in ethanol`
Type	string
Format	default

size_frac

Title (Label)	size_frac
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000017
Description	Filtering pore size used in sample preparation.
Examples	`0-0.22 micrometer`
Type	string
Format	default

samp_size

Title (Label)	samp_size
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000001
Description	Amount or size of sample (volume, mass or area) that was collected.
Examples	`5 liter`
Type	string
Format	default

samp_vol_we_dna_ext

Title (Label)	samp_vol_we_dna_ext
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000111
Description	Volume (ml) or mass (g) of total collected sample processed for DNA extraction. Note: total sample collected should be entered under the term Sample Size (MIXS:0000001).
Examples	`1500 milliliter`
Type	string
Format	default

source_uvig

Title (Label)	source_uvig
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000035
Description	Type of dataset from which the UViG was obtained.
Examples	`viral fraction metagenome (virome)`
Type	string
Format	default

virus_enrich_appr

Title (Label)	virus_enrich_appr
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000036
Description	List of approaches used to enrich the sample for viruses, if any.
Examples	`filtration + FeCl Precipitation + ultracentrifugation + DNAse`
Type	string
Format	default

nucl_acid_ext

Title (Label)	nucl_acid_ext
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000037
Description	A link to a literature reference, electronic resource or a standard operating procedure (SOP), that describes the material separation to recover the nucleic acid fraction from a sample.
Examples	`https://mobio.com/media/wysiwyg/pdfs/protocols/12888.pdf`
Type	string
Format	default

nucl_acid_amp

Title (Label)	nucl_acid_amp
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000038
Description	A link to a literature reference, electronic resource or a standard operating procedure (SOP), that describes the enzymatic amplification (PCR, TMA, NASBA) of specific nucleic acids.
Examples	`https://phylogenomics.me/protocols/16s-pcr-protocol/`
Type	string
Format	default

lib_size

Title (Label)	lib_size
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000039
Description	Total number of clones in the library prepared for the project.
Examples	`50`
Type	integer
Format	default

lib_reads_seqd

Title (Label)	lib_reads_seqd
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000040
Description	Total number of clones sequenced from the library.
Examples	`20`
Type	integer
Format	default

lib_layout

Title (Label)	lib_layout
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000041
Description	Specify whether to expect single, paired, or other configuration of reads.
Examples	`paired`
Type	string
Format	default

lib_vector

Title (Label)	lib_vector
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000042
Description	Cloning vector type(s) used in construction of libraries.
Examples	`Bacteriophage P1`
Type	string
Format	default

lib_screen

Title (Label)	lib_screen
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000043
Description	Specific enrichment or screening methods applied before and/or after creating libraries.
Examples	`enriched` `screened` `normalized`
Type	string
Format	default

target_gene

Title (Label)	target_gene
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000044
Description	Targeted gene or locus name for marker gene studies.
Examples	`16S rRNA` `18S rRNA` `nif` `amoA` `rpo`
Type	string
Format	default

target_subfragment

Title (Label)	target_subfragment
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000045
Description	Name of subfragment of a gene or locus. Important to e.g. identify special regions on marker genes like V6 on 16S rRNA.
Examples	`V6` `V9` `ITS`
Type	string
Format	default

pcr_primers

Title (Label)	pcr_primers
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000046
Description	PCR primers that were used to amplify the sequence of the targeted gene, locus or subfragment. This field should contain all the primers used for a single PCR reaction if multiple forward or reverse primers are present in a single PCR reaction. The primer sequence should be reported in uppercase letters.
Examples	`FWD:GTGCCAGCMGCCGCGGTAA REV:GGACTACHVGGGTWTCTAAT`
Type	string
Format	default

mid

Title (Label)	mid
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000047
Description	Molecular barcodes, called Multiplex Identifiers (MIDs), that are used to specifically tag unique samples in a sequencing run. Sequence should be reported in uppercase letters.
Examples	`GTGAATAT`
Type	string
Format	default

adapters

Title (Label)	adapters
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000048
Description	Adapters provide priming sequences for both amplification and sequencing of the sample-library fragments. Both adapters should be reported; in uppercase letters.
Examples	`AATGATACGGCGACCACCGAGATCTACACGCT CAAGCAGAAGACGGCATACGAGAT`
Type	string
Format	default

pcr_cond

Title (Label)	pcr_cond
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000049
Description	Description of reaction conditions and components of PCR in the form of ´initial denaturation:94degC_1.5min; annealing=...´.
Examples	`initial denaturation:94_3 annealing:50_1 elongation:72_1.5 final elongation:72_10 35`
Type	string
Format	default

seq_meth

Title (Label)	seq_meth
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000050
Description	Sequencing method used; e.g. Sanger, ABI-solid.
Examples	`Illumina HiSeq 1500`
Type	string
Format	default

seq_quality_check

Title (Label)	seq_quality_check
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000051
Description	Indicate if the sequence has been called by automatic systems (none) or undergone a manual editing procedure (e.g. by inspecting the raw data or chromatograms). Applied only for sequences that are not submitted to SRA,ENA or DRA.
Examples	`none`
Type	string
Format	default

chimera_check

Title (Label)	chimera_check
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000052
Description	A chimeric sequence, or chimera for short, is a sequence comprised of two or more phylogenetically distinct parent sequences. Chimeras are usually PCR artifacts thought to occur when a prematurely terminated amplicon reanneals to a foreign DNA strand and is copied to completion in the following PCR cycles. The point at which the chimeric sequence changes from one parent to the next is called the breakpoint or conversion point.
Examples	`uchime v4.1 default parameters`
Type	string
Format	default

tax_ident

Title (Label)	tax_ident
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000053
Description	The phylogenetic marker(s) used to assign an organism name to the SAG or MAG.
Examples	`other: rpoB gene`
Type	string
Format	default

assembly_qual

Title (Label)	assembly_qual
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000056
Description	The assembly quality category is based on sets of criteria outlined for each assembly quality category. For MISAG/MIMAG; Finished: Single, validated, contiguous sequence per replicon without gaps or ambiguities with a consensus error rate equivalent to Q50 or better. High Quality Draft:Multiple fragments where gaps span repetitive regions. Presence of the 23S, 16S and 5S rRNA genes and at least 18 tRNAs. Medium Quality Draft:Many fragments with little to no review of assembly other than reporting of standard assembly statistics. Low Quality Draft:Many fragments with little to no review of assembly other than reporting of standard assembly statistics. Assembly statistics include, but are not limited to total assembly size, number of contigs, contig N50/L50, and maximum contig length. For MIUVIG; Finished: Single, validated, contiguous sequence per replicon without gaps or ambiguities, with extensive manual review and editing to annotate putative gene functions and transcriptional units. High-quality draft genome: One or multiple fragments, totaling ≥ 90% of the expected genome or replicon sequence or predicted complete. Genome fragment(s): One or multiple fragments, totalling < 90% of the expected genome or replicon sequence, or for which no genome size could be estimated.
Examples	`High-quality draft genome`
Type	string
Format	default

assembly_name

Title (Label)	assembly_name
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000057
Description	Name/version of the assembly provided by the submitter that is used in the genome browsers and in the community.
Examples	`HuRef, JCVI_ISG_i3_1.0`
Type	string
Format	default

assembly_software

Title (Label)	assembly_software
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000058
Description	Tool(s) used for assembly, including version number and parameters.
Examples	`metaSPAdes 3.11.0 kmer set 21,33,55,77,99,121, default parameters otherwise`
Type	string
Format	default

annot

Title (Label)	annot
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000059
Description	Tool used for annotation, or for cases where annotation was provided by a community jamboree or model organism database rather than by a specific submitter.
Examples	`prokka`
Type	string
Format	default

number_contig

Title (Label)	number_contig
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000060
Description	Total number of contigs in the cleaned/submitted assembly that makes up a given genome, SAG, MAG, or UViG.
Examples	`40`
Type	integer
Format	default

feat_pred

Title (Label)	feat_pred
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000061
Description	Method used to predict UViGs features such as ORFs, integration site, etc.
Examples	`Prodigal 2.6.3 default parameters`
Type	string
Format	default

ref_db

Title (Label)	ref_db
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000062
Description	List of database(s) used for ORF annotation, along with version number and reference to website or publication.
Examples	`pVOGs 5 http://dmk-brain.ecn.uiowa.edu/pVOGs/ Grazziotin et al. 2017 doi:10.1093/nar/gkw975`
Type	string
Format	default

sim_search_meth

Title (Label)	sim_search_meth
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000063
Description	Tool used to compare ORFs with database, along with version and cutoffs used.
Examples	`HMMER3 3.1b2 hmmsearch, cutoff of 50 on score`
Type	string
Format	default

tax_class

Title (Label)	tax_class
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000064
Description	Method used for taxonomic classification, along with reference database used, classification rank, and thresholds used to classify new genomes.
Examples	`vConTACT vContact2 (references from NCBI RefSeq v83, genus rank classification, default parameters)`
Type	string
Format	default

_16s_recover

Title (Label)	_16s_recover
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000065
Description	Can a 16S gene be recovered from the submitted SAG or MAG?.
Examples	`yes`
Type	string
Format	default

_16s_recover_software

Title (Label)	_16s_recover_software
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000066
Description	Tools used for 16S rRNA gene extraction.
Examples	`rambl v2 default parameters`
Type	string
Format	default

trnas

Title (Label)	trnas
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000067
Description	The total number of tRNAs identified from the SAG or MAG.
Examples	`18`
Type	integer
Format	default

trna_ext_software

Title (Label)	trna_ext_software
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000068
Description	Tools used for tRNA identification.
Examples	`infernal v2 default parameters`
Type	string
Format	default

compl_score

Title (Label)	compl_score
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000069
Description	Completeness score is typically based on either the fraction of markers found as compared to a database or the percent of a genome found as compared to a closely related reference genome. High Quality Draft: >90%, Medium Quality Draft: >50%, and Low Quality Draft: < 50% should have the indicated completeness scores.
Examples	`med 60%`
Type	string
Format	default

compl_software

Title (Label)	compl_software
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000070
Description	Tools used for completion estimate, i.e. checkm, anvi´o, busco.
Examples	`checkm`
Type	string
Format	default

compl_appr

Title (Label)	compl_appr
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000071
Description	The approach used to determine the completeness of a given SAG or MAG, which would typically make use of a set of conserved marker genes or a closely related reference genome. For UViG completeness, include reference genome or group used, and contig feature suggesting a complete genome.
Examples	`other: UViG length compared to the average length of reference genomes from the P22virus genus (NCBI RefSeq v83)`
Type	string
Format	default

contam_score

Title (Label)	contam_score
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000072
Description	The contamination score is based on the fraction of single-copy genes that are observed more than once in a query genome. The following scores are acceptable for; High Quality Draft: < 5%, Medium Quality Draft: < 10%, Low Quality Draft: < 10%. Contamination must be below 5% for a SAG or MAG to be deposited into any of the public databases.
Examples	`1%`
Type	string
Format	default

contam_screen_input

Title (Label)	contam_screen_input
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000005
Description	The type of sequence data used as input.
Examples	`contigs`
Type	string
Format	default

contam_screen_param

Title (Label)	contam_screen_param
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000073
Description	Specific parameters used in the decontamination sofware, such as reference database, coverage, and kmers. Combinations of these parameters may also be used, i.e. kmer and coverage, or reference database and kmer.
Examples	`kmer`
Type	string
Format	default

decontam_software

Title (Label)	decontam_software
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000074
Description	Tool(s) used in contamination screening.
Examples	`anvi´o`
Type	string
Format	default

sort_tech

Title (Label)	sort_tech
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000075
Description	Method used to sort/isolate cells or particles of interest.
Examples	`optical manipulation`
Type	string
Format	default

single_cell_lysis_appr

Title (Label)	single_cell_lysis_appr
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000076
Description	Method used to free DNA from interior of the cell(s) or particle(s).
Examples	`enzymatic`
Type	string
Format	default

single_cell_lysis_prot

Title (Label)	single_cell_lysis_prot
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000054
Description	Name of the kit or standard protocol used for cell(s) or particle(s) lysis.
Examples	`ambion single cell lysis kit`
Type	string
Format	default

wga_amp_appr

Title (Label)	wga_amp_appr
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000055
Description	Method used to amplify genomic DNA in preparation for sequencing.
Examples	`mda based`
Type	string
Format	default

wga_amp_kit

Title (Label)	wga_amp_kit
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000006
Description	Kit used to amplify genomic DNA in preparation for sequencing.
Examples	`qiagen repli-g`
Type	string
Format	default

bin_param

Title (Label)	bin_param
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000077
Description	The parameters that have been applied during the extraction of genomes from metagenomic datasets.
Examples	`coverage` `kmer`
Type	string
Format	default

bin_software

Title (Label)	bin_software
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000078
Description	Tool(s) used for the extraction of genomes from metagenomic datasets.
Examples	`concoct` `maxbin`
Type	string
Format	default

reassembly_bin

Title (Label)	reassembly_bin
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000079
Description	Has an assembly been performed on a genome bin extracted from a metagenomic assembly?.
Examples	`no`
Type	string
Format	default

mag_cov_software

Title (Label)	mag_cov_software
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000080
Description	Tool(s) used to determine the genome coverage if coverage is used as a binning parameter in the extraction of genomes from metagenomic datasets.
Examples	`bbmap`
Type	string
Format	default

vir_ident_software

Title (Label)	vir_ident_software
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000081
Description	Tool(s) used for the identification of UViG as a viral genome, software or protocol name including version number, parameters, and cutoffs used.
Examples	`VirSorter 1.0.4 Virome database, category 2`
Type	string
Format	default

pred_genome_type

Title (Label)	pred_genome_type
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000082
Description	Type of genome predicted for the UViG.
Examples	`dsDNA`
Type	string
Format	default

pred_genome_struc

Title (Label)	pred_genome_struc
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000083
Description	Expected structure of the viral genome.
Examples	`non-segmented`
Type	string
Format	default

detec_type

Title (Label)	detec_type
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000084
Description	Type of UViG detection.
Examples	`independent sequence (UViG)`
Type	string
Format	default

otu_class_appr

Title (Label)	otu_class_appr
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000085
Description	Cutoffs and approach used when clustering new UViGs in "species-level" OTUs. Note that results from standard 95% ANI / 85% AF clustering should be provided alongside OTUS defined from another set of thresholds, even if the latter are the ones primarily used during the analysis.
Examples	`95% ANI 85% AF greedy incremental clustering`
Type	string
Format	default

otu_seq_comp_appr

Title (Label)	otu_seq_comp_appr
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000086
Description	Tool and thresholds used to compare sequences when computing "species-level" OTUs.
Examples	`blastn 2.6.0+ e-value cutoff: 0.001`
Type	string
Format	default

otu_db

Title (Label)	otu_db
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000087
Description	Reference database (i.e. sequences not generated as part of the current study) used to cluster new genomes in "species-level" OTUs, if any.
Examples	`NCBI Viral RefSeq 83`
Type	string
Format	default

host_pred_appr

Title (Label)	host_pred_appr
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000088
Description	Tool or approach used for host prediction.
Examples	`CRISPR spacer match`
Type	string
Format	default

host_pred_est_acc

Title (Label)	host_pred_est_acc
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000089
Description	For each tool or approach used for host prediction, estimated false discovery rates should be included, either computed de novo or from the literature.
Examples	`CRISPR spacer match: 0 or 1 mismatches, estimated 8% FDR at the host genus rank (Edwards et al. 2016 doi:10.1093/femsre/fuv048)`
Type	string
Format	default

associated_resource

Title (Label)	associated_resource
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000091
Description	A related resource that is referenced, cited, or otherwise associated to the sequence.
Examples	`http://www.earthmicrobiome.org/`
Type	string
Format	default

sop

Title (Label)	sop
Namespace	mixs
Table:	MolecularProtocol
IRI	https://w3id.org/mixs/0000090
Description	Standard operating procedures used in assembly and/or annotation of genomes, metagenomes or environmental sequences.
Examples	`http://press.igsb.anl.gov/earthmicrobiome/protocols-and-standards/its/`
Type	string
Format	default

pcr_primer_forward

Title (Label)	pcr_primer_forward
Namespace	gbif
Table:	MolecularProtocol
IRI	http://rs.gbif.org/terms/pcr_primer_forward
Description	Forward PCR primer that were used to amplify the sequence of the targeted gene, locus or subfragment. If multiple multiple forward or reverse primers are present in a single PCR reaction, there should be a full row for each of these linked to the same dwc:Occurrence. The primer sequence should be reported in uppercase letters.
Examples	`GGACTACHVGGGTWTCTAAT`
Type	string
Format	default

pcr_primer_reverse

Title (Label)	pcr_primer_reverse
Namespace	gbif
Table:	MolecularProtocol
IRI	http://rs.gbif.org/terms/pcr_primer_reverse
Description	Reverse PCR primer that were used to amplify the sequence of the targeted gene, locus or subfragment. If multiple multiple forward or reverse primers are present in a single PCR reaction, there should be a full row for each of these linked to the same dwc:Occurrence. The primer sequence should be reported in uppercase letters.
Examples	`GGACTACHVGGGTWTCTAAT`
Type	string
Format	default

pcr_primer_name_forward

Title (Label)	pcr_primer_name_forward
Namespace	gbif
Table:	MolecularProtocol
IRI	http://rs.gbif.org/terms/pcr_primer_name_forward
Description	Name of the forward PCR primer that were used to amplify the sequence of the targeted gene, locus or subfragment. If multiple multiple forward or reverse primers are present in a single PCR reaction, there should be a full row for each of these linked to the same dwc:Occurrence.
Examples	`jgLCO1490`
Type	string
Format	default

pcr_primer_name_reverse

Title (Label)	pcr_primer_name_reverse
Namespace	gbif
Table:	MolecularProtocol
IRI	http://rs.gbif.org/terms/pcr_primer_name_reverse
Description	Name of the reverse PCR primer that were used to amplify the sequence of the targeted gene, locus or subfragment. If multiple multiple forward or reverse primers are present in a single PCR reaction, there should be a full row for each of these linked to the same dwc:Occurrence.
Examples	`jgHCO2198`
Type	string
Format	default

pcr_primer_reference

Title (Label)	pcr_primer_reference
Namespace	gbif
Table:	MolecularProtocol
IRI	http://rs.gbif.org/terms/pcr_primer_reference
Description	Reference for the PCR primers that were used to amplify the sequence of the targeted gene, locus or subfragment.
Examples	`https://doi.org/10.1186/1742-9994-10-34`
Type	string
Format	default

DNA_sequence

Title (Label)	DNA_sequence
Namespace	gbif
Table:	MolecularProtocol
IRI	http://rs.gbif.org/terms/dna_sequence
Description	A DNA sequence.
Examples	`TCTATCCTCAATTATAGGTCATAATTCACCATCAGTAGATTTAGGAATTTTCTCTATTCATATTGCAGGTGTATCATCAATTATAGGATCAATTAATTTTATTGTAACAATTTTAAATATACATACAAAAACTCATTCATTAAACTTTTTACCATTATTTTCATGATCAGTTCTAGTTACAGCAATTCTCCTTTTATTATCATTA`
Type	string
Format	default

concentration

Title (Label)	concentration
Namespace	ggbn
Table:	MolecularProtocol
IRI	http://data.ggbn.org/schemas/ggbn/terms/concentration
Description	Concentration of DNA (weight ng/volume µl).
Examples	`67.5`
Type	number
Format	default

concentrationUnit

Title (Label)	concentrationUnit
Namespace	ggbn
Table:	MolecularProtocol
IRI	http://data.ggbn.org/schemas/ggbn/terms/concentrationUnit
Description	Unit used for concentration measurement.
Examples	`ng/µl`
Type	string
Format	default

methodDeterminationConcentrationAndRatios

Title (Label)	methodDeterminationConcentrationAndRatios
Namespace	ggbn
Table:	MolecularProtocol
IRI	http://data.ggbn.org/schemas/ggbn/terms/methodDeterminationConcentrationAndRatios
Description	Description of method used for concentration measurement.
Examples	`Nanodrop` `Qubit`
Type	string
Format	default

ratioOfAbsorbance260_230

Title (Label)	ratioOfAbsorbance260_230
Namespace	ggbn
Table:	MolecularProtocol
IRI	http://data.ggbn.org/schemas/ggbn/terms/ratioOfAbsorbance260_230
Description	Ratio of absorbance at 260 nm and 230 nm assessing DNA purity (mostly secondary measure, indicates mainly EDTA, carbohydrates, phenol), (DNA samples only).
Examples	`1.89`
Type	number
Format	default

ratioOfAbsorbance260_280

Title (Label)	ratioOfAbsorbance260_280
Namespace	ggbn
Table:	MolecularProtocol
IRI	http://data.ggbn.org/schemas/ggbn/terms/ratioOfAbsorbance260_280
Description	Ratio of absorbance at 280 nm and 230 nm assessing DNA purity (mostly secondary measure, indicates mainly EDTA, carbohydrates, phenol), (DNA samples only).
Examples	`1.91`
Type	number
Format	default

annealingTemp

Title (Label)	annealingTemp
Namespace	miqe
Table:	MolecularProtocol
IRI	http://rs.gbif.org/terms/miqe/annealingTemp
Description	The reaction temperature during the annealing phase of PCR.
Examples	`60`
Type	number
Format	default

annealingTempUnit

Title (Label)	annealingTempUnit
Namespace	miqe
Table:	MolecularProtocol
IRI	http://rs.gbif.org/terms/miqe/annealingTempUnit
Description	Measurement unit of the reaction temperature during the annealing phase of PCR.
Examples	`Degrees celsius`
Type	string
Format	default

probeReporter

Title (Label)	probeReporter
Namespace	miqe
Table:	MolecularProtocol
IRI	http://rs.gbif.org/terms/miqe/probeReporter
Description	Type of fluorophore (reporter) used. Probe anneals within amplified target DNA. Polymerase activity degrades the probe that has annealed to the template, and the probe releases the fluorophore from it and breaks the proximity to the quencher, thus allowing fluorescence of the fluorophore.
Examples	`FAM`
Type	string
Format	default

probeQuencher

Title (Label)	probeQuencher
Namespace	miqe
Table:	MolecularProtocol
IRI	http://rs.gbif.org/terms/miqe/probeQuencher
Description	Type of quencher used. The quencher molecule quenches the fluorescence emitted by the fluorophore when excited by the cycler’s light source As long as fluorophore and the quencher are in proximity, quenching inhibits any fluorescence signals.
Examples	`NFQ-MGB`
Type	string
Format	default

ampliconSize

Title (Label)	ampliconSize
Namespace	miqe
Table:	MolecularProtocol
IRI	http://rs.gbif.org/terms/miqe/ampliconSize
Description	The length of the amplicon in basepairs.
Examples	`83`
Type	integer
Format	default

thresholdQuantificationCycle

Title (Label)	thresholdQuantificationCycle
Namespace	miqe
Table:	MolecularProtocol
IRI	http://rs.gbif.org/terms/miqe/thresholdQuantificationCycle
Description	Threshold for change in fluorescence signal between cycles.
Examples	`0.3`
Type	number
Format	default

baselineValue

Title (Label)	baselineValue
Namespace	miqe
Table:	MolecularProtocol
IRI	http://rs.gbif.org/terms/miqe/baselineValue
Description	The number of cycles when fluorescence signal from the target amplification is below background fluorescence not originated from the real target amplification.
Examples	`15`
Type	integer
Format	default

quantificationCycle

Title (Label)	quantificationCycle
Namespace	miqe
Table:	MolecularProtocol
IRI	http://rs.gbif.org/terms/miqe/quantificationCycle
Description	The number of cycles required for the fluorescent signal to cross a given value threshold above the baseline. Quantification cycle (Cq), threshold cycle (Ct), crossing point (Cp), and take-off point (TOP) refer to the same value from the real-time instrument. Use of quantification cycle (Cq), is preferable according to the RDML (Real-Time PCR Data Markup Language) data standard (http://www.rdml.org).
Examples	`37.9450950622558`
Type	number
Format	default

automaticThresholdQuantificationCycle

Title (Label)	automaticThresholdQuantificationCycle
Namespace	miqe
Table:	MolecularProtocol
IRI	http://rs.gbif.org/terms/miqe/automaticThresholdQuantificationCycle
Description	Whether the threshold was set by the instrument or manually.
Examples	`true`
Type	boolean
Format	default

automaticBaselineValue

Title (Label)	automaticBaselineValue
Namespace	miqe
Table:	MolecularProtocol
IRI	http://rs.gbif.org/terms/miqe/automaticBaselineValue
Description	Whether the baseline value was set by the instrument or manually.
Examples	`true`
Type	string
Format	default

contaminationAssessment

Title (Label)	contaminationAssessment
Namespace	miqe
Table:	MolecularProtocol
IRI	http://rs.gbif.org/terms/miqe/contaminationAssessment
Description	Whether DNA or RNA contamination assessment was done or not.
Examples	`true`
Type	string
Format	default

partitionVolume

Title (Label)	partitionVolume
Namespace	miqe
Table:	MolecularProtocol
IRI	http://rs.gbif.org/terms/miqe/partitionVolume
Description	An accurate estimation of partition volume. The sum of the partitions multiplied by the partition volume will enable the total volume of the reaction to be calculated.
Examples	`1`
Type	number
Format	default

partitionVolumeUnit

Title (Label)	partitionVolumeUnit
Namespace	miqe
Table:	MolecularProtocol
IRI	http://rs.gbif.org/terms/miqe/partitionVolumeUnit
Description	Unit used for partition volume.
Examples	`nl`
Type	string
Format	default

estimatedNumberOfCopies

Title (Label)	estimatedNumberOfCopies
Namespace	miqe
Table:	MolecularProtocol
IRI	http://rs.gbif.org/terms/miqe/estimatedNumberOfCopies
Description	Number of target molecules per µl. Mean copies per partition (?) can be calculated using the number of partitions (n) and the estimated copy number in the total volume of all partitions (m) with a formula ?=m/n.
Examples	`10300`
Type	integer
Format	default

amplificationReactionVolume

Title (Label)	amplificationReactionVolume
Namespace	miqe
Table:	MolecularProtocol
IRI	http://rs.gbif.org/terms/miqe/amplificationReactionVolume
Description	PCR reaction volume.
Examples	`22`
Type	number
Format	default

amplificationReactionVolumeUnit

Title (Label)	amplificationReactionVolumeUnit
Namespace	miqe
Table:	MolecularProtocol
IRI	http://rs.gbif.org/terms/miqe/amplificationReactionVolumeUnit
Description	Unit used for PCR reaction volume. Many of the instruments require preparation of a much larger initial sample volume than is actually analyzed.
Examples	`µl`
Type	string
Format	default

pcr_analysis_software

Title (Label)	pcr_analysis_software
Namespace	miqe
Table:	MolecularProtocol
IRI	http://rs.gbif.org/terms/miqe/pcr_analysis_software
Description	The program used to analyse the d(d)PCR runs.
Examples	`BIO-RAD QuantaSoft`
Type	string
Format	default

experimentalVariance

Title (Label)	experimentalVariance
Namespace	miqe
Table:	MolecularProtocol
IRI	http://rs.gbif.org/terms/miqe/experimentalVariance
Description	Multiple biological replicates are encouraged to assess total experimental variation. When single dPCR experiments are performed, a minimal estimate of variance due to counting error alone must be calculated from the binomial (or suitable equivalent) distribution.
Type	string
Format	default

pcr_primer_lod

Title (Label)	pcr_primer_lod
Namespace	miqe
Table:	MolecularProtocol
IRI	http://rs.gbif.org/terms/miqe/pcr_primer_lod
Description	The assay’s ability to detect the target at low levels.
Examples	`51`
Type	string
Format	default

pcr_primer_loq

Title (Label)	pcr_primer_loq
Namespace	miqe
Table:	MolecularProtocol
IRI	http://rs.gbif.org/terms/miqe/pcr_primer_loq
Description	The assay’s ability to quantify copy number at low levels.
Examples	`184`
Type	string
Format	default

NucleotideSequence

Identifier: http://rs.tdwg.org/dwc/dwc-dp/nucleotide-sequence

Description: A digital representation of a nucleotide sequence.

nucleotideSequenceID

Title (Label)	Nucleotide Sequence ID
Namespace	dwcdp
Table:	NucleotideSequence
Description	An identifier for a NucleotideSequence.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': True}
Format	default

nucleotideSequence

Title (Label)	Nucleotide Sequence
Namespace	dwcdp
Table:	NucleotideSequence
Description	A string representing nucleotide base pairs.
Type	string
Format	default

nucleotideSequenceRemarks

Title (Label)	Nucleotide Sequence Remarks
Namespace	dwcdp
Table:	NucleotideSequence
Description	Comments or notes about a NucleotideSequence.
Type	string
Format	default

PhylogeneticTree

Identifier: http://rs.tdwg.org/dwc/dwc-dp/phylogenetic-tree

Description: A branching diagram that shows the evolutionary relationships between dwc:Organisms.

Relationships to Other Tables

Field	Target Table	Target Field	Required
phylogeneticTreeProtocolID	protocol	protocolID	No

phylogeneticTreeID

Title (Label)	Phylogenetic Tree ID
Namespace	dwcdp
Table:	PhylogeneticTree
Description	An identifier for a PhylogeneticTree.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': True}
Format	default

phylogeneticTreeProtocol

Title (Label)	Phylogenetic Tree Protocol
Namespace	dwcdp
Table:	PhylogeneticTree
IRI	http://rs.tdwg.org/dwc/terms/measurementMethod
Description	A description of or reference to the Protocol used to make a PhylogeneticTree.
Type	string
Format	default

phylogeneticTreeProtocolID

Title (Label)	Phylogenetic Tree Protocol ID
Namespace	dwcdp
Table:	PhylogeneticTree
IRI	http://rs.tdwg.org/dwc/iri/measurementMethod
Description	An identifier for a Protocol used to make a PhylogeneticTree.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Format	default

phylogeneticTreeReference

Title (Label)	Phylogenetic Tree Reference
Namespace	dwcdp
Table:	PhylogeneticTree
Description	A bibliographic reference in which a PhylogeneticTree is mentioned.
Type	string
Format	default

phylogeneticTreeRemarks

Title (Label)	Phylogenetic Tree Remarks
Namespace	dwcdp
Table:	PhylogeneticTree
Description	Comments or notes about a PhylogeneticTree.
Type	string
Format	default

PhylogeneticTreeTip

Identifier: http://rs.tdwg.org/dwc/dwc-dp/phylogenetic-tree-tip

Description: A group of Taxa at the end of a branch of a PhylogeneticTree as determined from relationships between dwc:Organisms.

Relationships to Other Tables

Field	Target Table	Target Field	Required
phylogeneticTreeID	phylogenetic-tree	phylogeneticTreeID	Yes
materialEntityID	material	materialEntityID	Yes
nucleotideSequenceID	nucleotide-sequence	nucleotideSequenceID	Yes

phylogeneticTreeTipID

Title (Label)	Phylogenetic Tree Tip ID
Namespace	dwcdp
Table:	PhylogeneticTreeTip
Description	An identifier for a PhylogeneticTreeTip.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': True}
Format	default

phylogeneticTreeID

Title (Label)	Phylogenetic Tree ID
Namespace	dwcdp
Table:	PhylogeneticTreeTip
Description	An identifier for a PhylogeneticTree.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

phylogeneticTreeTipLabel

Title (Label)	Phylogenetic Tree Tip Label
Namespace	dwcdp
Table:	PhylogeneticTreeTip
Description	A label applied to a PhylogeneticTreeTip.
Examples	`Ministrymon sp. nov. 1`
Type	string
Format	default

taxonID

Title (Label)	Taxon ID
Namespace	dwc
Table:	PhylogeneticTreeTip
IRI	http://rs.tdwg.org/dwc/terms/taxonID
Description	An identifier for a dwc:Taxon.
Comments	In DwC-DP, the taxonID is always an external link to a taxon record. As such, if present, it should be a resolvable globally unique identifier. See the Identifiers section of https://github.com/CatalogueOfLife/coldp/blob/master/README.md.
Examples	`col:6W3C4` `worms:212808` `ipni:320035-2`
Type	string
Format	default

scientificName

Title (Label)	Scientific Name
Namespace	dwc
Table:	PhylogeneticTreeTip
IRI	http://rs.tdwg.org/dwc/terms/scientificName
Description	A full scientific name, with authorship and date information if known. When forming part of a dwc:Identification, this should be the name in lowest level taxonomic rank that can be determined. This term should not contain identification qualifications, which should instead be supplied in dwc:verbatimIdentification.
Examples	`Coleoptera` (order) `Vespertilionidae` (family) `Manis` (genus) `Ctenomys sociabilis` (genus + specificEpithet) `Ambystoma tigrinum diaboli` (genus + specificEpithet + infraspecificEpithet) `Roptrocerus typographi (Györfi, 1952)` (genus + specificEpithet + scientificNameAuthorship) `Quercus agrifolia var. oxyadenia (Torr.) J.T. Howell` (genus + specificEpithet + taxonRank + infraspecificEpithet + scientificNameAuthorship)
Type	string
Format	default

materialEntityID

Title (Label)	Material Entity ID
Namespace	dwc
Table:	PhylogeneticTreeTip
IRI	http://rs.tdwg.org/dwc/terms/materialEntityID
Description	An identifier for a dwc:MaterialEntity.
Comments	Values of dwc:materialEntityID are intended to uniquely and persistently identify a particular dwc:MaterialEntity within some context. Examples of context include a particular sample collection, an organization, or the worldwide scale. Recommended best practice is to use a persistent, globally unique identifier. The identifier is bound to a physical object (a dwc:MaterialEntity) as opposed to a particular digital record (representation) of that physical object.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

nucleotideSequenceID

Title (Label)	Nucleotide Sequence ID
Namespace	dwcdp
Table:	PhylogeneticTreeTip
Description	An identifier for a NucleotideSequence.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': True}
Format	default

Agent

Identifier: http://rs.tdwg.org/dwc/dwc-dp/agent

Description: A person, group, organization, machine, software or other entity that can act.

Examples:

`Carl Linnaeus`

`The Terra Nova Expedition`

`The National Science Foundation`

`The El Yunque National Forest ARBIMON System`

`ChatGPT`

agentID

Title (Label)	Agent ID
Namespace	dwcdp
Table:	Agent
Description	An identifier for an Agent.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': True}
Format	default

agentType

Title (Label)	Agent Type
Namespace	dwcdp
Table:	Agent
Description	A category that best matches the nature of an Agent.
Comments	Recommended best practice is to use a controlled vocabulary.
Examples	`person` `group` `organization` `camera`
Type	string
Format	default

agentTypeIRI

Title (Label)	Agent Type IRI
Namespace	dwcdp
Table:	Agent
Description	An IRI of a controlled vocabulary value for a type of Agent.
Comments	Recommended best practice is to use an IRI for a term in a controlled vocabulary.
Type	string
Format	default

agentTypeVocabulary

Title (Label)	Agent Type Vocabulary
Namespace	dwcdp
Table:	Agent
Description	A reference to a controlled vocabulary in which the definition of a value in agentType is given.
Type	string
Format	default

preferredAgentName

Title (Label)	Preferred Agent Name
Namespace	dwcdp
Table:	Agent
Description	A name of an Agent preferred in searches and results.
Type	string
Format	default

AgentAgentRole

Identifier: http://rs.tdwg.org/dwc/dwc-dp/agent-agent-role

Description: A role filled by an Agent with respect to another Agent.

Examples:

`an instance of an Agent that is a person is the director of another instance of an Agent that is an organization`

`an instance of an Agent that is a person is a member of another instance of an Agent that is a group`

`an instance of an Agent that is a person is the author of another instance of an Agent that is software`

Relationships to Other Tables

Field	Target Table	Target Field	Required
agentID	agent	agentID	Yes
relatedAgentID	agent	agentID	Yes

agentID

Title (Label)	Agent ID
Namespace	dwcdp
Table:	AgentAgentRole
Description	An identifier for an Agent.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

relatedAgentID

Title (Label)	Related Agent ID
Namespace	dwcdp
Table:	AgentAgentRole
Description	An identifier for a related Agent.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

agentRole

Title (Label)	Agent Role
Namespace	dwcdp
Table:	AgentAgentRole
Description	A category that best matches the nature of a role of an Agent.
Comments	Recommended best practice is to use a controlled vocabulary for the roles appropriate to the class of resource an AgentRole is related to.
Examples	`collector` `preparator` `organizer` `author` `creator` `owner` `observer` `director` `husband`
Type	string
Format	default

agentRoleIRI

Title (Label)	Agent Role IRI
Namespace	dwcdp
Table:	AgentAgentRole
Description	An IRI of the controlled vocabulary value for a role of an Agent.
Comments	Recommended best practice is to use an IRI for a term in a controlled vocabulary.
Type	string
Format	default

agentRoleVocabulary

Title (Label)	Agent Role Vocabulary
Namespace	dwcdp
Table:	AgentAgentRole
Description	A reference to a controlled vocabulary in which the definition of a value in agentRole is given.
Type	string
Format	default

agentRoleOrder

Title (Label)	Agent Role Order
Namespace	dwcdp
Table:	AgentAgentRole
Description	A numerical position of an AgentRole in a set of AgentRoles that have the same combination of agentRole, agentRoleIRI, agentRoleVocabulary and related target.
Comments	One could use agentRoleOrder to create an ordered list of collectors (agentRole = 'collector') for a dwc:MaterialEntity, for example. The first would have agentRoleOrder=1, the second would have agentRoleOrder=2.
Examples	`1` `2` `3`
Type	integer
Constraints	{'required': False, 'minimum': 1}
Format	default

agentRoleDate

Title (Label)	Agent Role Date
Namespace	dwcdp
Table:	AgentAgentRole
Description	An interval during which an AgentRole was in effect.
Comments	Recommended best practice is to use a date that conforms to ISO 8601-1:2019.
Examples	`2024-07-29`
Type	string
Format	default

ChronometricAgeAgentRole

Identifier: http://rs.tdwg.org/dwc/dwc-dp/chronometric-age-agent-role

Description: A role filled by an Agent with respect to a chrono:ChronometricAge.

Relationships to Other Tables

Field	Target Table	Target Field	Required
agentID	agent	agentID	Yes
chronometricAgeID	chronometric-age	chronometricAgeID	Yes

agentID

Title (Label)	Agent ID
Namespace	dwcdp
Table:	ChronometricAgeAgentRole
Description	An identifier for an Agent.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

chronometricAgeID

Title (Label)	Chronometric Age ID
Namespace	chrono
Table:	ChronometricAgeAgentRole
IRI	http://rs.tdwg.org/chrono/terms/chronometricAgeID
Description	An identifier for a chrono:ChronometricAge.
Comments	Recommended best practice is to use a globally unique identifier.
Examples	`https://www.canadianarchaeology.ca/samples/70673`
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

agentRole

Title (Label)	Agent Role
Namespace	dwcdp
Table:	ChronometricAgeAgentRole
Description	A category that best matches the nature of a role of an Agent.
Comments	Recommended best practice is to use a controlled vocabulary for the roles appropriate to the class of resource an AgentRole is related to.
Examples	`collector` `preparator` `organizer` `author` `creator` `owner` `observer` `director` `husband`
Type	string
Format	default

agentRoleIRI

Title (Label)	Agent Role IRI
Namespace	dwcdp
Table:	ChronometricAgeAgentRole
Description	An IRI of the controlled vocabulary value for a role of an Agent.
Comments	Recommended best practice is to use an IRI for a term in a controlled vocabulary.
Type	string
Format	default

agentRoleVocabulary

Title (Label)	Agent Role Vocabulary
Namespace	dwcdp
Table:	ChronometricAgeAgentRole
Description	A reference to a controlled vocabulary in which the definition of a value in agentRole is given.
Type	string
Format	default

agentRoleOrder

Title (Label)	Agent Role Order
Namespace	dwcdp
Table:	ChronometricAgeAgentRole
Description	A numerical position of an AgentRole in a set of AgentRoles that have the same combination of agentRole, agentRoleIRI, agentRoleVocabulary and related target.
Comments	One could use agentRoleOrder to create an ordered list of collectors (agentRole = 'collector') for a dwc:MaterialEntity, for example. The first would have agentRoleOrder=1, the second would have agentRoleOrder=2.
Examples	`1` `2` `3`
Type	integer
Constraints	{'required': False, 'minimum': 1}
Format	default

agentRoleDate

Title (Label)	Agent Role Date
Namespace	dwcdp
Table:	ChronometricAgeAgentRole
Description	An interval during which an AgentRole was in effect.
Comments	Recommended best practice is to use a date that conforms to ISO 8601-1:2019.
Examples	`2024-07-29`
Type	string
Format	default

EventAgentRole

Identifier: http://rs.tdwg.org/dwc/dwc-dp/event-agent-role

Description: A role filled by an Agent with respect to a dwc:Event.

Relationships to Other Tables

Field	Target Table	Target Field	Required
agentID	agent	agentID	Yes
eventID	event	eventID	Yes

agentID

Title (Label)	Agent ID
Namespace	dwcdp
Table:	EventAgentRole
Description	An identifier for an Agent.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

eventID

Title (Label)	Event ID
Namespace	dwc
Table:	EventAgentRole
IRI	http://rs.tdwg.org/dwc/terms/eventID
Description	An identifier for a dwc:Event.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

agentRole

Title (Label)	Agent Role
Namespace	dwcdp
Table:	EventAgentRole
Description	A category that best matches the nature of a role of an Agent.
Comments	Recommended best practice is to use a controlled vocabulary for the roles appropriate to the class of resource an AgentRole is related to.
Examples	`collector` `preparator` `organizer` `author` `creator` `owner` `observer` `director` `husband`
Type	string
Format	default

agentRoleIRI

Title (Label)	Agent Role IRI
Namespace	dwcdp
Table:	EventAgentRole
Description	An IRI of the controlled vocabulary value for a role of an Agent.
Comments	Recommended best practice is to use an IRI for a term in a controlled vocabulary.
Type	string
Format	default

agentRoleVocabulary

Title (Label)	Agent Role Vocabulary
Namespace	dwcdp
Table:	EventAgentRole
Description	A reference to a controlled vocabulary in which the definition of a value in agentRole is given.
Type	string
Format	default

agentRoleOrder

Title (Label)	Agent Role Order
Namespace	dwcdp
Table:	EventAgentRole
Description	A numerical position of an AgentRole in a set of AgentRoles that have the same combination of agentRole, agentRoleIRI, agentRoleVocabulary and related target.
Comments	One could use agentRoleOrder to create an ordered list of collectors (agentRole = 'collector') for a dwc:MaterialEntity, for example. The first would have agentRoleOrder=1, the second would have agentRoleOrder=2.
Examples	`1` `2` `3`
Type	integer
Constraints	{'required': False, 'minimum': 1}
Format	default

agentRoleDate

Title (Label)	Agent Role Date
Namespace	dwcdp
Table:	EventAgentRole
Description	An interval during which an AgentRole was in effect.
Comments	Recommended best practice is to use a date that conforms to ISO 8601-1:2019.
Examples	`2024-07-29`
Type	string
Format	default

IdentificationAgentRole

Identifier: http://rs.tdwg.org/dwc/dwc-dp/identification-agent-role

Description: A role filled by an Agent with respect to a dwc:Identification.

Relationships to Other Tables

Field	Target Table	Target Field	Required
agentID	agent	agentID	Yes
identificationID	identification	identificationID	Yes

agentID

Title (Label)	Agent ID
Namespace	dwcdp
Table:	IdentificationAgentRole
Description	An identifier for an Agent.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

identificationID

Title (Label)	Identification ID
Namespace	dwc
Table:	IdentificationAgentRole
IRI	http://rs.tdwg.org/dwc/terms/identificationID
Description	An identifier for a dwc:Identification.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

agentRole

Title (Label)	Agent Role
Namespace	dwcdp
Table:	IdentificationAgentRole
Description	A category that best matches the nature of a role of an Agent.
Comments	Recommended best practice is to use a controlled vocabulary for the roles appropriate to the class of resource an AgentRole is related to.
Examples	`collector` `preparator` `organizer` `author` `creator` `owner` `observer` `director` `husband`
Type	string
Format	default

agentRoleIRI

Title (Label)	Agent Role IRI
Namespace	dwcdp
Table:	IdentificationAgentRole
Description	An IRI of the controlled vocabulary value for a role of an Agent.
Comments	Recommended best practice is to use an IRI for a term in a controlled vocabulary.
Type	string
Format	default

agentRoleVocabulary

Title (Label)	Agent Role Vocabulary
Namespace	dwcdp
Table:	IdentificationAgentRole
Description	A reference to a controlled vocabulary in which the definition of a value in agentRole is given.
Type	string
Format	default

agentRoleOrder

Title (Label)	Agent Role Order
Namespace	dwcdp
Table:	IdentificationAgentRole
Description	A numerical position of an AgentRole in a set of AgentRoles that have the same combination of agentRole, agentRoleIRI, agentRoleVocabulary and related target.
Comments	One could use agentRoleOrder to create an ordered list of collectors (agentRole = 'collector') for a dwc:MaterialEntity, for example. The first would have agentRoleOrder=1, the second would have agentRoleOrder=2.
Examples	`1` `2` `3`
Type	integer
Constraints	{'required': False, 'minimum': 1}
Format	default

agentRoleDate

Title (Label)	Agent Role Date
Namespace	dwcdp
Table:	IdentificationAgentRole
Description	An interval during which an AgentRole was in effect.
Comments	Recommended best practice is to use a date that conforms to ISO 8601-1:2019.
Examples	`2024-07-29`
Type	string
Format	default

MaterialAgentRole

Identifier: http://rs.tdwg.org/dwc/dwc-dp/material-agent-role

Description: A role filled by an Agent with respect to a dwc:MaterialEntity.

Relationships to Other Tables

Field	Target Table	Target Field	Required
agentID	agent	agentID	Yes
materialEntityID	material	materialEntityID	Yes

agentID

Title (Label)	Agent ID
Namespace	dwcdp
Table:	MaterialAgentRole
Description	An identifier for an Agent.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

materialEntityID

Title (Label)	Material Entity ID
Namespace	dwc
Table:	MaterialAgentRole
IRI	http://rs.tdwg.org/dwc/terms/materialEntityID
Description	An identifier for a dwc:MaterialEntity.
Comments	Values of dwc:materialEntityID are intended to uniquely and persistently identify a particular dwc:MaterialEntity within some context. Examples of context include a particular sample collection, an organization, or the worldwide scale. Recommended best practice is to use a persistent, globally unique identifier. The identifier is bound to a physical object (a dwc:MaterialEntity) as opposed to a particular digital record (representation) of that physical object.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

agentRole

Title (Label)	Agent Role
Namespace	dwcdp
Table:	MaterialAgentRole
Description	A category that best matches the nature of a role of an Agent.
Comments	Recommended best practice is to use a controlled vocabulary for the roles appropriate to the class of resource an AgentRole is related to.
Examples	`collector` `preparator` `organizer` `author` `creator` `owner` `observer` `director` `husband`
Type	string
Format	default

agentRoleIRI

Title (Label)	Agent Role IRI
Namespace	dwcdp
Table:	MaterialAgentRole
Description	An IRI of the controlled vocabulary value for a role of an Agent.
Comments	Recommended best practice is to use an IRI for a term in a controlled vocabulary.
Type	string
Format	default

agentRoleVocabulary

Title (Label)	Agent Role Vocabulary
Namespace	dwcdp
Table:	MaterialAgentRole
Description	A reference to a controlled vocabulary in which the definition of a value in agentRole is given.
Type	string
Format	default

agentRoleOrder

Title (Label)	Agent Role Order
Namespace	dwcdp
Table:	MaterialAgentRole
Description	A numerical position of an AgentRole in a set of AgentRoles that have the same combination of agentRole, agentRoleIRI, agentRoleVocabulary and related target.
Comments	One could use agentRoleOrder to create an ordered list of collectors (agentRole = 'collector') for a dwc:MaterialEntity, for example. The first would have agentRoleOrder=1, the second would have agentRoleOrder=2.
Examples	`1` `2` `3`
Type	integer
Constraints	{'required': False, 'minimum': 1}
Format	default

agentRoleDate

Title (Label)	Agent Role Date
Namespace	dwcdp
Table:	MaterialAgentRole
Description	An interval during which an AgentRole was in effect.
Comments	Recommended best practice is to use a date that conforms to ISO 8601-1:2019.
Examples	`2024-07-29`
Type	string
Format	default

MediaAgentRole

Identifier: http://rs.tdwg.org/dwc/dwc-dp/media-agent-role

Description: A role filled by an Agent with respect to a Media entity.

Relationships to Other Tables

Field	Target Table	Target Field	Required
agentID	agent	agentID	Yes
mediaID	media	mediaID	Yes

agentID

Title (Label)	Agent ID
Namespace	dwcdp
Table:	MediaAgentRole
Description	An identifier for an Agent.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

mediaID

Title (Label)	Media ID
Namespace	dwcdp
Table:	MediaAgentRole
Description	An identifier for a Media instance.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

agentRole

Title (Label)	Agent Role
Namespace	dwcdp
Table:	MediaAgentRole
Description	A category that best matches the nature of a role of an Agent.
Comments	Recommended best practice is to use a controlled vocabulary for the roles appropriate to the class of resource an AgentRole is related to.
Examples	`collector` `preparator` `organizer` `author` `creator` `owner` `observer` `director` `husband`
Type	string
Format	default

agentRoleIRI

Title (Label)	Agent Role IRI
Namespace	dwcdp
Table:	MediaAgentRole
Description	An IRI of the controlled vocabulary value for a role of an Agent.
Comments	Recommended best practice is to use an IRI for a term in a controlled vocabulary.
Type	string
Format	default

agentRoleVocabulary

Title (Label)	Agent Role Vocabulary
Namespace	dwcdp
Table:	MediaAgentRole
Description	A reference to a controlled vocabulary in which the definition of a value in agentRole is given.
Type	string
Format	default

agentRoleOrder

Title (Label)	Agent Role Order
Namespace	dwcdp
Table:	MediaAgentRole
Description	A numerical position of an AgentRole in a set of AgentRoles that have the same combination of agentRole, agentRoleIRI, agentRoleVocabulary and related target.
Comments	One could use agentRoleOrder to create an ordered list of collectors (agentRole = 'collector') for a dwc:MaterialEntity, for example. The first would have agentRoleOrder=1, the second would have agentRoleOrder=2.
Examples	`1` `2` `3`
Type	integer
Constraints	{'required': False, 'minimum': 1}
Format	default

agentRoleDate

Title (Label)	Agent Role Date
Namespace	dwcdp
Table:	MediaAgentRole
Description	An interval during which an AgentRole was in effect.
Comments	Recommended best practice is to use a date that conforms to ISO 8601-1:2019.
Examples	`2024-07-29`
Type	string
Format	default

MolecularProtocolAgentRole

Identifier: http://rs.tdwg.org/dwc/dwc-dp/molecular-protocol-agent-role

Description: A role filled by an Agent with respect to a MolecularProtocol.

Relationships to Other Tables

Field	Target Table	Target Field	Required
agentID	agent	agentID	Yes
molecularProtocolID	molecular-protocol	molecularProtocolID	Yes

agentID

Title (Label)	Agent ID
Namespace	dwcdp
Table:	MolecularProtocolAgentRole
Description	An identifier for an Agent.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

molecularProtocolID

Title (Label)	Molecular Protocol ID
Namespace	dwcdp
Table:	MolecularProtocolAgentRole
Description	An identifier for a MolecularProtocol.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

agentRole

Title (Label)	Agent Role
Namespace	dwcdp
Table:	MolecularProtocolAgentRole
Description	A category that best matches the nature of a role of an Agent.
Comments	Recommended best practice is to use a controlled vocabulary for the roles appropriate to the class of resource an AgentRole is related to.
Examples	`collector` `preparator` `organizer` `author` `creator` `owner` `observer` `director` `husband`
Type	string
Format	default

agentRoleIRI

Title (Label)	Agent Role IRI
Namespace	dwcdp
Table:	MolecularProtocolAgentRole
Description	An IRI of the controlled vocabulary value for a role of an Agent.
Comments	Recommended best practice is to use an IRI for a term in a controlled vocabulary.
Type	string
Format	default

agentRoleVocabulary

Title (Label)	Agent Role Vocabulary
Namespace	dwcdp
Table:	MolecularProtocolAgentRole
Description	A reference to a controlled vocabulary in which the definition of a value in agentRole is given.
Type	string
Format	default

agentRoleOrder

Title (Label)	Agent Role Order
Namespace	dwcdp
Table:	MolecularProtocolAgentRole
Description	A numerical position of an AgentRole in a set of AgentRoles that have the same combination of agentRole, agentRoleIRI, agentRoleVocabulary and related target.
Comments	One could use agentRoleOrder to create an ordered list of collectors (agentRole = 'collector') for a dwc:MaterialEntity, for example. The first would have agentRoleOrder=1, the second would have agentRoleOrder=2.
Examples	`1` `2` `3`
Type	integer
Constraints	{'required': False, 'minimum': 1}
Format	default

agentRoleDate

Title (Label)	Agent Role Date
Namespace	dwcdp
Table:	MolecularProtocolAgentRole
Description	An interval during which an AgentRole was in effect.
Comments	Recommended best practice is to use a date that conforms to ISO 8601-1:2019.
Examples	`2024-07-29`
Type	string
Format	default

OccurrenceAgentRole

Identifier: http://rs.tdwg.org/dwc/dwc-dp/occurrence-agent-role

Description: A role filled by an Agent with respect to a dwc:Occurrence.

Relationships to Other Tables

Field	Target Table	Target Field	Required
agentID	agent	agentID	Yes
occurrenceID	occurrence	occurrenceID	Yes

agentID

Title (Label)	Agent ID
Namespace	dwcdp
Table:	OccurrenceAgentRole
Description	An identifier for an Agent.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

occurrenceID

Title (Label)	Occurrence ID
Namespace	dwc
Table:	OccurrenceAgentRole
IRI	http://rs.tdwg.org/dwc/terms/occurrenceID
Description	An identifier for a dwc:Occurrence.
Comments	Recommended best practice is to use a persistent, globally unique identifier. In the absence of a persistent global unique identifier, construct one from a combination of identifiers in the record that will most closely make a dwc:occurrenceID globally unique.
Examples	`http://arctos.database.museum/guid/MSB:Mamm:233627`
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

agentRole

Title (Label)	Agent Role
Namespace	dwcdp
Table:	OccurrenceAgentRole
Description	A category that best matches the nature of a role of an Agent.
Comments	Recommended best practice is to use a controlled vocabulary for the roles appropriate to the class of resource an AgentRole is related to.
Examples	`collector` `preparator` `organizer` `author` `creator` `owner` `observer` `director` `husband`
Type	string
Format	default

agentRoleIRI

Title (Label)	Agent Role IRI
Namespace	dwcdp
Table:	OccurrenceAgentRole
Description	An IRI of the controlled vocabulary value for a role of an Agent.
Comments	Recommended best practice is to use an IRI for a term in a controlled vocabulary.
Type	string
Format	default

agentRoleVocabulary

Title (Label)	Agent Role Vocabulary
Namespace	dwcdp
Table:	OccurrenceAgentRole
Description	A reference to a controlled vocabulary in which the definition of a value in agentRole is given.
Type	string
Format	default

agentRoleOrder

Title (Label)	Agent Role Order
Namespace	dwcdp
Table:	OccurrenceAgentRole
Description	A numerical position of an AgentRole in a set of AgentRoles that have the same combination of agentRole, agentRoleIRI, agentRoleVocabulary and related target.
Comments	One could use agentRoleOrder to create an ordered list of collectors (agentRole = 'collector') for a dwc:MaterialEntity, for example. The first would have agentRoleOrder=1, the second would have agentRoleOrder=2.
Examples	`1` `2` `3`
Type	integer
Constraints	{'required': False, 'minimum': 1}
Format	default

agentRoleDate

Title (Label)	Agent Role Date
Namespace	dwcdp
Table:	OccurrenceAgentRole
Description	An interval during which an AgentRole was in effect.
Comments	Recommended best practice is to use a date that conforms to ISO 8601-1:2019.
Examples	`2024-07-29`
Type	string
Format	default

OrganismInteractionAgentRole

Identifier: http://rs.tdwg.org/dwc/dwc-dp/organism-interaction-agent-role

Description: A role filled by an Agent with respect to an OrganismInteraction.

Relationships to Other Tables

Field	Target Table	Target Field	Required
agentID	agent	agentID	Yes
organismInteractionID	organism-interaction	organismInteractionID	Yes

agentID

Title (Label)	Agent ID
Namespace	dwcdp
Table:	OrganismInteractionAgentRole
Description	An identifier for an Agent.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

organismInteractionID

Title (Label)	Organism Interaction ID
Namespace	dwcdp
Table:	OrganismInteractionAgentRole
Description	An identifier for an OrganismInteraction.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

agentRole

Title (Label)	Agent Role
Namespace	dwcdp
Table:	OrganismInteractionAgentRole
Description	A category that best matches the nature of a role of an Agent.
Comments	Recommended best practice is to use a controlled vocabulary for the roles appropriate to the class of resource an AgentRole is related to.
Examples	`collector` `preparator` `organizer` `author` `creator` `owner` `observer` `director` `husband`
Type	string
Format	default

agentRoleIRI

Title (Label)	Agent Role IRI
Namespace	dwcdp
Table:	OrganismInteractionAgentRole
Description	An IRI of the controlled vocabulary value for a role of an Agent.
Comments	Recommended best practice is to use an IRI for a term in a controlled vocabulary.
Type	string
Format	default

agentRoleVocabulary

Title (Label)	Agent Role Vocabulary
Namespace	dwcdp
Table:	OrganismInteractionAgentRole
Description	A reference to a controlled vocabulary in which the definition of a value in agentRole is given.
Type	string
Format	default

agentRoleOrder

Title (Label)	Agent Role Order
Namespace	dwcdp
Table:	OrganismInteractionAgentRole
Description	A numerical position of an AgentRole in a set of AgentRoles that have the same combination of agentRole, agentRoleIRI, agentRoleVocabulary and related target.
Comments	One could use agentRoleOrder to create an ordered list of collectors (agentRole = 'collector') for a dwc:MaterialEntity, for example. The first would have agentRoleOrder=1, the second would have agentRoleOrder=2.
Examples	`1` `2` `3`
Type	integer
Constraints	{'required': False, 'minimum': 1}
Format	default

agentRoleDate

Title (Label)	Agent Role Date
Namespace	dwcdp
Table:	OrganismInteractionAgentRole
Description	An interval during which an AgentRole was in effect.
Comments	Recommended best practice is to use a date that conforms to ISO 8601-1:2019.
Examples	`2024-07-29`
Type	string
Format	default

SurveyAgentRole

Identifier: http://rs.tdwg.org/dwc/dwc-dp/survey-agent-role

Description: A role filled by an Agent with respect to a Survey.

Relationships to Other Tables

Field	Target Table	Target Field	Required
agentID	agent	agentID	Yes
surveyID	survey	surveyID	Yes

agentID

Title (Label)	Agent ID
Namespace	dwcdp
Table:	SurveyAgentRole
Description	An identifier for an Agent.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

surveyID

Title (Label)	Survey ID
Namespace	dwcdp
Table:	SurveyAgentRole
Description	An identifier for a Survey.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

agentRole

Title (Label)	Agent Role
Namespace	dwcdp
Table:	SurveyAgentRole
Description	A category that best matches the nature of a role of an Agent.
Comments	Recommended best practice is to use a controlled vocabulary for the roles appropriate to the class of resource an AgentRole is related to.
Examples	`collector` `preparator` `organizer` `author` `creator` `owner` `observer` `director` `husband`
Type	string
Format	default

agentRoleIRI

Title (Label)	Agent Role IRI
Namespace	dwcdp
Table:	SurveyAgentRole
Description	An IRI of the controlled vocabulary value for a role of an Agent.
Comments	Recommended best practice is to use an IRI for a term in a controlled vocabulary.
Type	string
Format	default

agentRoleVocabulary

Title (Label)	Agent Role Vocabulary
Namespace	dwcdp
Table:	SurveyAgentRole
Description	A reference to a controlled vocabulary in which the definition of a value in agentRole is given.
Type	string
Format	default

agentRoleOrder

Title (Label)	Agent Role Order
Namespace	dwcdp
Table:	SurveyAgentRole
Description	A numerical position of an AgentRole in a set of AgentRoles that have the same combination of agentRole, agentRoleIRI, agentRoleVocabulary and related target.
Comments	One could use agentRoleOrder to create an ordered list of collectors (agentRole = 'collector') for a dwc:MaterialEntity, for example. The first would have agentRoleOrder=1, the second would have agentRoleOrder=2.
Examples	`1` `2` `3`
Type	integer
Constraints	{'required': False, 'minimum': 1}
Format	default

agentRoleDate

Title (Label)	Agent Role Date
Namespace	dwcdp
Table:	SurveyAgentRole
Description	An interval during which an AgentRole was in effect.
Comments	Recommended best practice is to use a date that conforms to ISO 8601-1:2019.
Examples	`2024-07-29`
Type	string
Format	default

Media

Identifier: http://rs.tdwg.org/dwc/dwc-dp/media

Description: A dcmi:MediaType (dcmi:Sounds, dcmi:StillImages, dcmi:MovingImages or dcmi:Text) with other entities as content.

Comments: An instance of digital textual media may be better represented as a Reference.

Examples:

`a digital image`

`a camera trap image series`

`a video`

`a clip from a sound recording`

`a digital 3D mesh representing a specimen`

Relationships to Other Tables

Field	Target Table	Target Field	Required
commenter	agent	agentID	No
reviewer	agent	agentID	No
sourceIRI	agent	agentID	No
creatorIRI	agent	agentID	No
provider	agent	agentID	No
metadataCreator	agent	agentID	No
metadataProvider	agent	agentID	No

mediaID

Title (Label)	Media ID
Namespace	dwcdp
Table:	Media
Description	An identifier for a Media instance.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': True}
Format	default

mediaType

Title (Label)	Media Type
Namespace	dcterms
Table:	Media
IRI	http://purl.org/dc/terms/type
Description	A category that best matches the nature of an instance of Media.
Examples	`Sound` `StillImage` `MovingImage` `Text`
Type	string
Format	default

subtypeLiteral

Title (Label)	SubtypeLiteral
Namespace	ac
Table:	Media
IRI	http://rs.tdwg.org/ac/terms/subtypeLiteral
Description	The subtype should provide more specialization than the type. Possible values are community-defined. For examples see the non-normative page AC_Subtype_Examples.
Type	string
Format	default

subtype

Title (Label)	Subtype
Namespace	ac
Table:	Media
IRI	http://rs.tdwg.org/ac/terms/subtype
Description	Any URI may be used that provides for more specialization than the type. Possible values are community-defined. For exmamples see the non-normative page AC_Subtype_Examples.
Examples	`Photograph` `Animation` `Drawing`
Type	string
Format	default

title

Title (Label)	Title
Namespace	dcterms
Table:	Media
IRI	http://purl.org/dc/terms/title
Description	Concise title, name, or brief descriptive label of institution, resource collection, or individual resource. This field should include the complete title with all the subtitles, if any.
Examples	`Epistenia coeruleata: head frontal view`
Type	string
Format	default

modified

Title (Label)	Modified
Namespace	dcterms
Table:	Media
IRI	http://purl.org/dc/terms/modified
Description	Date that the media resource was altered. The date and time must comply with the World Wide Web Consortium (W3C) datetime practice, which requires that date and time representation correspond to ISO 8601:1998, but with year fields always comprising 4 digits. This makes datetime records compliant with 8601:2004. AC datetime values may also follow 8601:2004 for ranges by separating two IS0 8601 datetime fields by a solidus (`forward slash`; '/'). See also the wikipedia IS0 8601 entry for further explanation and examples.
Examples	`2007-02-16`
Type	string
Format	default

MetadataDate

Title (Label)	MetadataDate
Namespace	xmp
Table:	Media
IRI	http://ns.adobe.com/xap/1.0/MetadataDate
Description	Point in time recording when the last modification to metadata (not necessarily the media object itself) occurred. The date and time must comply with the World Wide Web Consortium (W3C) datetime practice, which requires that date and time representation correspond to ISO 8601:1998, but with year fields always comprising 4 digits. This makes datetime records compliant with 8601:2004. AC datetime values may also follow 8601:2004 for ranges by separating two IS0 8601 datetime fields by a solidus (`forward slash`; '/'). See also the wikipedia IS0 8601 entry for further explanation and examples.
Type	string
Format	default

metadataLanguageLiteral

Title (Label)	MetadataLanguageLiteral
Namespace	ac
Table:	Media
IRI	http://rs.tdwg.org/ac/terms/metadataLanguageLiteral
Description	Language of description and other metadata (but not necessarily of the image itself) represented as an ISO639-2 three letter language code. ISO639-1 two-letter codes are permitted but deprecated. Note: At least one of ac:metadataLanguage and ac:metadataLanguageLiteral must be supplied but, when feasible, supplying both may make the metadata more widely useful.
Examples	`eng` `fre`
Type	string
Format	default

metadataLanguage

Title (Label)	MetadataLanguage
Namespace	ac
Table:	Media
IRI	http://rs.tdwg.org/ac/terms/metadataLanguage
Description	URI from the ISO639-2 list of URIs for ISO 3-letter language codes. Note: At least one of ac:metadataLanguage and ac:metadataLanguageLiteral must be supplied but, when feasible, supplying both may make the metadata more widely useful
Examples	`http://www.lexvo.org/page/iso639-3/eng` `http://www.lexvo.org/page/iso639-3/fra`
Type	string
Format	default

commenterLiteral

Title (Label)	CommenterLiteral
Namespace	ac
Table:	Media
IRI	http://rs.tdwg.org/ac/terms/commenterLiteral
Description	A name or the literal `anonymous` (= anonymously commented).
Type	string
Format	default

commenter

Title (Label)	Commenter
Namespace	ac
Table:	Media
IRI	http://rs.tdwg.org/ac/terms/commenter
Description	A URI denoting a person, using some controlled vocabulary such as FOAF. Implementers and communities of practice may produce restrictions or recommendations on the choice of vocabularies. See also the entry for ac:commenterLiteral in this document and the section Namespaces, Prefixes and Term Names for discussion of the rationale for separate terms taking URI values from those taking Literal values where both are possible. Normal practice is to use the same Label if both are provided. Labels have no effect on information discovery and are only suggestions.
Type	string
Format	default

comments

Title (Label)	Comments
Namespace	ac
Table:	Media
IRI	http://rs.tdwg.org/ac/terms/comments
Description	Any comment provided on the media resource, as free-form text. Best practice would also identify the commenter.
Type	string
Format	default

reviewerLiteral

Title (Label)	ReviewerLiteral
Namespace	ac
Table:	Media
IRI	http://rs.tdwg.org/ac/terms/reviewerLiteral
Description	String providing the name of a reviewer. If present, then resource is peer-reviewed, even if Reviewer Comments is absent or empty. Its presence tells whether an expert in the subject featured in the media has reviewed the media item or collection and approved its metadata description; must display a name or the literal `anonymous` (= anonymously reviewed).
Type	string
Format	default

reviewer

Title (Label)	Reviewer
Namespace	ac
Table:	Media
IRI	http://rs.tdwg.org/ac/terms/reviewer
Description	URI for a reviewer. If present, then resource is peer-reviewed, even if there are Reviewer Comments is absent or empty. Its presence tells whether an expert in the subject featured in the media has reviewed the media item or collection and approved its metadata description; must display a name or the literal `anonymous` (= anonymously reviewed).
Type	string
Format	default

reviewerComments

Title (Label)	ReviewerComments
Namespace	ac
Table:	Media
IRI	http://rs.tdwg.org/ac/terms/reviewerComments
Description	Any comment provided by a reviewer with expertise in the subject, as free-form text.
Type	string
Format	default

available

Title (Label)	Available
Namespace	dcterms
Table:	Media
IRI	http://purl.org/dc/terms/available
Description	The date (often a range) that the resource became or will become available. The date and time must comply with the World Wide Web Consortium (W3C) datetime practice, which requires that date and time representation correspond to ISO 8601:1998, but with year fields always comprising 4 digits. This makes datetime records compliant with 8601:2004. AC datetime values may also follow 8601:2004 for ranges by separating two IS0 8601 datetime fields by a solidus (`forward slash`; '/'). See also the wikipedia IS0 8601 entry for further explanation and examples.
Examples	`2007-02-16`
Type	string
Format	default

hasServiceAccessPoint

Title (Label)	HasServiceAccessPoint
Namespace	ac
Table:	Media
IRI	http://rs.tdwg.org/ac/terms/hasServiceAccessPoint
Description	In a chosen serialization (RDF, XML Schema, etc.) the potentially multiple service access points (e.g., for different resolutions of an image) might be provided in a referenced or in a nested object. This property identifies one such access point. That is, each of potentially multiple values of hasServiceAccessPoint identifies a set of representation-dependent metadata using the properties defined under the section Service Access Point Vocabulary.
Type	string
Format	default

rights

Title (Label)	Rights
Namespace	dc
Table:	Media
IRI	http://purl.org/dc/elements/1.1/rights
Description	Information about rights held in and over the resource. A full-text, readable copyright statement, as required by the national legislation of the copyright holder. On collections, this applies to all contained objects, unless the object itself has a different statement. Examples: “Copyright XY 2008, all rights reserved”, “© 2008 XY Museum” , `Public Domain.`; `Copyright unknown.` Do not place just the name of the copyright holder(s) here! That belongs in a list in the xmpRights:Owner field, which should be supplied if dc:rights is not 'Public Domain', which is appropriate only if the resource is known to be not under copyright. See also the entry for dcterms:rights in this document and see the DCMI FAQ on DC and DCTERMS Namespaces for discussion of the rationale for terms in two namespaces. Normal practice is to use the same Label if both are provided. Labels have no effect on information discovery and are only suggestions.
Examples	`Copyright 2014 Ron Thomas` or a URI like `http://creativecommons.org/licenses/by/3.0/legalcode`
Type	string
Format	default

rightsIRI

Title (Label)	Rights IRI
Namespace	dcterms
Table:	Media
IRI	http://purl.org/dc/terms/rights
Description	A URI pointing to structured information about rights held in and over the resource. Examples include http://creativecommons.org/licenses/by/3.0/legalcode and http://creativecommons.org/publicdomain/zero/1.0/. At least one of dcterms:rights and dc:rights must be supplied but, when feasible, supplying both may make the metadata more widely useful. They must specify the same rights. In case of ambiguity, dcterms:rights prevails.
Type	string
Format	default

Owner

Title (Label)	Owner
Namespace	xmpRights
Table:	Media
IRI	http://ns.adobe.com/xap/1.0/rights/Owner
Description	A list of the names of the owners of the copyright. 'Unknown' is an acceptable value, but 'Public Domain' is not.
Examples	`The names of the owners `Ron Thomas, Roz Thomas` or a URI that identifies the owner`
Type	string
Format	default

UsageTerms

Title (Label)	UsageTerms
Namespace	xmpRights
Table:	Media
IRI	http://ns.adobe.com/xap/1.0/rights/UsageTerms
Description	The license statement defining how resources may be used. Information on a collection applies to all contained objects unless the object has a different statement.
Type	string
Format	default

WebStatement

Title (Label)	WebStatement
Namespace	xmpRights
Table:	Media
IRI	http://ns.adobe.com/xap/1.0/rights/WebStatement
Description	A URL defining or further elaborating on the license statement (e. g., a web page explaining the precise terms of use).
Examples	`http://creativecommons.org/licenses/by-nc-sa/3.0/us/`
Type	string
Format	default

licenseLogoURL

Title (Label)	LicenseLogoURL
Namespace	ac
Table:	Media
IRI	http://rs.tdwg.org/ac/terms/licenseLogoURL
Description	A URL providing access to a logo that symbolizes the License.
Examples	`http://i.creativecommons.org/l/by-nc-sa/3.0/us/88x31.png`
Type	string
Format	default

Credit

Title (Label)	Credit
Namespace	photoshop
Table:	Media
IRI	http://ns.adobe.com/photoshop/1.0/Credit
Description	free text for `Please cite this as…`
Type	string
Format	default

attributionLogoURL

Title (Label)	AttributionLogoURL
Namespace	ac
Table:	Media
IRI	http://rs.tdwg.org/ac/terms/attributionLogoURL
Description	The URL of the icon or logo image to appear in source attribution.
Examples	`http://www.morphbank.net/images/userLogos/11a.jpg`
Type	string
Format	default

attributionLinkURL

Title (Label)	AttributionLinkURL
Namespace	ac
Table:	Media
IRI	http://rs.tdwg.org/ac/terms/attributionLinkURL
Description	The URL where information about ownership, attribution, etc. of the resource may be found.
Type	string
Format	default

fundingAttribution

Title (Label)	FundingAttribution
Namespace	ac
Table:	Media
IRI	http://rs.tdwg.org/ac/terms/fundingAttribution
Description	Organizations or individuals who funded the creation of the resource.
Type	string
Format	default

fundingAttributionID

Title (Label)	Funding Atribution ID
Namespace	dwc
Table:	Media
IRI	http://rs.tdwg.org/dwc/terms/fundingAttributionID
Description	A list (concatenated and separated) of the globally unique identifiers for the funding organizations or agencies that supported the project.
Comments	Provide a unique identifier for the funding body, such as an identifier used in governmental or international databases. If no official identifier exists, use a persistent and unique identifier within your organization or dataset. The recommended best practice is to separate the values in a list with space vertical bar space ( \| ).
Examples	`https://ror.org/00epmv149` `https://ror.org/00epmv149 \| https://ror.org/04jnzhb65` `https://www.wikidata.org/wiki/Q13102615`
Type	string
Format	default

source

Title (Label)	Source
Namespace	dc
Table:	Media
IRI	http://purl.org/dc/elements/1.1/source
Description	A string providing an identifiable source from which the described resources was derived.
Type	string
Format	default

sourceIRI

Title (Label)	Source IRI
Namespace	dcterms
Table:	Media
IRI	http://purl.org/dc/terms/source
Description	URI for an identifiable source from which the described resources was derived.
Examples	`http://biocol.org/institution/australian-national-insect-collection`
Type	string
Format	default

creator

Title (Label)	Creator
Namespace	dc
Table:	Media
IRI	http://purl.org/dc/elements/1.1/creator
Description	The person or organization responsible for creating the media resource.
Examples	`Michael Gates`
Type	string
Format	default

creatorIRI

Title (Label)	Creator IRI
Namespace	dcterms
Table:	Media
IRI	http://purl.org/dc/terms/creator
Description	A URI representing the person or organization responsible for creating the media resource.
Examples	`http://orcid.org/0000-0002-4879-3367`
Type	string
Format	default

providerLiteral

Title (Label)	ProviderLiteral
Namespace	ac
Table:	Media
IRI	http://rs.tdwg.org/ac/terms/providerLiteral
Description	Person or organization responsible for presenting the media resource. If no separate Metadata Provider is given, this also attributes the metadata.
Type	string
Format	default

provider

Title (Label)	Provider
Namespace	ac
Table:	Media
IRI	http://rs.tdwg.org/ac/terms/provider
Description	URI for person or organization responsible for presenting the media resource. If no separate Metadata Provider is given, this also attributes the metadata.
Examples	`http://morphbank.net`
Type	string
Format	default

metadataCreatorLiteral

Title (Label)	MetadataCreatorLiteral
Namespace	ac
Table:	Media
IRI	http://rs.tdwg.org/ac/terms/metadataCreatorLiteral
Description	Person or organization originally creating the resource metadata record.
Examples	`Michael Gates`
Type	string
Format	default

metadataCreator

Title (Label)	MetadataCreator
Namespace	ac
Table:	Media
IRI	http://rs.tdwg.org/ac/terms/metadataCreator
Description	Person or organization originally creating the resource metadata record.
Examples	`http://www.morphbank.net/?id=77638`
Type	string
Format	default

metadataProviderLiteral

Title (Label)	MetadataProviderLiteral
Namespace	ac
Table:	Media
IRI	http://rs.tdwg.org/ac/terms/metadataProviderLiteral
Description	Person or organization originally responsible for providing the resource metadata record.
Examples	`Morphbank`
Type	string
Format	default

metadataProvider

Title (Label)	MetadataProvider
Namespace	ac
Table:	Media
IRI	http://rs.tdwg.org/ac/terms/metadataProvider
Description	URI of person or organization originally responsible for providing the resource metadata record.
Examples	`http://morphbank.net`
Type	string
Format	default

description

Title (Label)	Description
Namespace	dcterms
Table:	Media
IRI	http://purl.org/dc/terms/description
Description	Description of collection or individual resource, containing the Who, What, When, Where and Why as free-form text. This normative document is silent on the nature of formatting in the text. It is the role of implementers of an AC concrete representation (e.g., an XML Schema, an RDF representation, etc.) to decide and document how formatting advice will be represented in descriptions serialized according to such representations.
Examples	`Epistenia coeruleata: head frontal view`
Type	string
Format	default

caption

Title (Label)	Caption
Namespace	ac
Table:	Media
IRI	http://rs.tdwg.org/ac/terms/caption
Description	As alternative or in addition to description, a caption is free-form text to be displayed together with (rather than instead of) a resource that is suitable for captions (especially images).
Type	string
Format	default

language

Title (Label)	Language
Namespace	dc
Table:	Media
IRI	http://purl.org/dc/elements/1.1/language
Description	Language(s) of resource itself represented in the ISO639-2 three-letter language code. ISO639-1 two-letter codes are permitted but deprecated.
Examples	`eng` `fre`
Type	string
Format	default

languageIRI

Title (Label)	Language IRI
Namespace	dcterms
Table:	Media
IRI	http://purl.org/dc/terms/language
Description	URI from the ISO639-2 list of URIs for ISO 3-letter language codes.
Examples	`http://lexvo.org/id/iso639-3/eng`
Type	string
Format	default

tag

Title (Label)	Tag
Namespace	ac
Table:	Media
IRI	http://rs.tdwg.org/ac/terms/tag
Description	General keywords or tags.
Examples	`head, wasp, eyes, blue`
Type	string
Format	default

CreateDate

Title (Label)	CreateDate
Namespace	xmp
Table:	Media
IRI	http://ns.adobe.com/xap/1.0/CreateDate
Description	The date of the creation of the original resource from which the digital media was derived or created. The date and time must comply with the World Wide Web Consortium (W3C) datetime practice, which requires that date and time representation correspond to ISO 8601:1998, but with year fields always comprising 4 digits. This makes datetime records compliant with 8601:2004. AC datetime values may also follow 8601:2004 for ranges by separating two IS0 8601 datetime fields by a solidus (`forward slash`; '/'). See also the wikipedia IS0 8601 entry for further explanation and examples.
Type	string
Format	default

timeOfDay

Title (Label)	TimeOfDay
Namespace	ac
Table:	Media
IRI	http://rs.tdwg.org/ac/terms/timeOfDay
Description	Free text information beyond exact clock times.
Type	string
Format	default

captureDevice

Title (Label)	CaptureDevice
Namespace	ac
Table:	Media
IRI	http://rs.tdwg.org/ac/terms/captureDevice
Description	Free form text describing the device or devices used to create the resource.
Examples	`digital camera, UV pass filter`
Type	string
Format	default

resourceCreationTechnique

Title (Label)	ResourceCreationTechnique
Namespace	ac
Table:	Media
IRI	http://rs.tdwg.org/ac/terms/resourceCreationTechnique
Description	Information about technical aspects of the creation and digitization process of the resource. This includes modification steps (`retouching`) after the initial resource capture.
Examples	`Cleared in KOH, platinum-coated`
Type	string
Format	default

collectionCode

Title (Label)	Collection Code
Namespace	dwc
Table:	Media
IRI	http://rs.tdwg.org/dwc/terms/collectionCode
Description	A name, acronym, coden, or initialism identifying a Collection.
Examples	`Mammals` `Hildebrandt` `EBIRD` `VP`
Type	string
Format	default

collectionID

Title (Label)	Collection ID
Namespace	dwc
Table:	Media
IRI	http://rs.tdwg.org/dwc/terms/collectionID
Description	An identifier for a Collection.
Comments	For physical specimens, the recommended best practice is to use a globally unique and resolvable identifier from a collections registry such as the Global Registry of Scientific Collections (https://scientific-collections.gbif.org/).
Examples	`https://scientific-collections.gbif.org/collection/fbd3ed74-5a21-4e01-b86a-33d36f032d9c`
Type	string
Format	default

derivedFrom

Title (Label)	DerivedFrom
Namespace	ac
Table:	Media
IRI	http://rs.tdwg.org/ac/terms/derivedFrom
Description	A reference to an original resource from which the current one is derived.
Type	string
Format	default

accessURI

Title (Label)	AccessURI
Namespace	ac
Table:	Media
IRI	http://rs.tdwg.org/ac/terms/accessURI
Description	A URI that uniquely identifies a service that provides a representation of the underlying resource. If this resource can be acquired by an http request, its http URL should be given. If not, but it has some URI in another URI scheme, that may be given here.
Examples	`http://images.morphbank.net/?id=135233&imgType=jpeg`
Type	string
Format	default

format

Title (Label)	Format
Namespace	dc
Table:	Media
IRI	http://purl.org/dc/elements/1.1/format
Description	A string describing the technical format of the resource (file format or physical medium).
Examples	`tiff` `jpeg`
Type	string
Format	default

formatIRI

Title (Label)	Format
Namespace	dcterms
Table:	Media
IRI	http://purl.org/dc/terms/format
Description	URI referencing the technical format of the resource (file format or physical medium).
Examples	`http://mediatypes.appspot.com/jpeg`
Type	string
Format	default

variantLiteral

Title (Label)	VariantLiteral
Namespace	ac
Table:	Media
IRI	http://rs.tdwg.org/ac/terms/variantLiteral
Description	Text that describes this Service Access Point variant.
Examples	`Best Quality`
Type	string
Format	default

variant

Title (Label)	Variant
Namespace	ac
Table:	Media
IRI	http://rs.tdwg.org/ac/terms/variant
Description	A URI designating what this Service Access Point provides. Some suggested values are the URIs ac:Thumbnail, ac:Trailer, ac:LowerQuality, ac:MediumQuality, ac:GoodQuality, ac:BestQuality, and ac:Offline. Additional URIs from communities of practice may be introduced.
Type	string
Format	default

variantDescription

Title (Label)	VariantDescription
Namespace	ac
Table:	Media
IRI	http://rs.tdwg.org/ac/terms/variantDescription
Description	Text that describes this Service Access Point variant
Type	string
Format	default

furtherInformationURL

Title (Label)	FurtherInformationURL
Namespace	ac
Table:	Media
IRI	http://rs.tdwg.org/ac/terms/furtherInformationURL
Description	The URL of a Web site that provides additional information about the version of the media resource that is provided by the Service Access Point.
Examples	`http://www.morphbank.net/135233`
Type	string
Format	default

licensingException

Title (Label)	LicensingException
Namespace	ac
Table:	Media
IRI	http://rs.tdwg.org/ac/terms/licensingException
Description	The licensing statement for this variant of the media resource if different from that given in the License Statement property of the resource.
Type	string
Format	default

serviceExpectation

Title (Label)	ServiceExpectation
Namespace	ac
Table:	Media
IRI	http://rs.tdwg.org/ac/terms/serviceExpectation
Description	A term that describes what service expectations users may have of the ac:accessURL. Recommended terms include online (denotes that the URL is expected to deliver the resource), authenticate (denotes that the URL delivers a login or other authentication interface requiring completion before delivery of the resource) published(non digital) (denotes that the URL is the identifier of a non-digital published work, for example a doi.) Communities should develop their own controlled vocabularies for Service Expectations.
Type	string
Format	default

hashFunction

Title (Label)	HashFunction
Namespace	ac
Table:	Media
IRI	http://rs.tdwg.org/ac/terms/hashFunction
Description	The cryptographic hash function used to compute the value given in the Hash Value.
Type	string
Format	default

hashValue

Title (Label)	HashValue
Namespace	ac
Table:	Media
IRI	http://rs.tdwg.org/ac/terms/hashValue
Description	The value computed by a hash function applied to the media that will be delivered at the access point.
Type	string
Format	default

PixelXDimension

Title (Label)	PixelXDimension
Namespace	exif
Table:	Media
IRI	http://ns.adobe.com/exif/1.0/PixelXDimension
Description	The width in pixels of the media specified by the access point.
Examples	`2000 x 1500`
Type	string
Format	default

PixelYDimension

Title (Label)	PixelYDimension
Namespace	exif
Table:	Media
IRI	http://ns.adobe.com/exif/1.0/PixelYDimension
Description	The height in pixels of the media specified by the access point.
Type	string
Format	default

feedbackURL

Title (Label)	Feedback URL
Namespace	dwc
Table:	Media
IRI	http://rs.tdwg.org/dwc/terms/feedbackURL
Comments	A uniform resource locator (URL) that points to a webpage on which a form may be submitted to gather feedback about the record.
Type	string
Format	default

AgentMedia

Identifier: http://rs.tdwg.org/dwc/dwc-dp/agent-media

Description: A link establishing an Agent as content in a Media entity.

Examples:

`a person shown in a photograph`

`a group of people in a video`

Relationships to Other Tables

Field	Target Table	Target Field	Required
mediaID	media	mediaID	Yes
agentID	agent	agentID	Yes

mediaID

Title (Label)	Media ID
Namespace	dwcdp
Table:	AgentMedia
Description	An identifier for a Media instance.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

agentID

Title (Label)	Agent ID
Namespace	dwcdp
Table:	AgentMedia
Description	An identifier for an Agent.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

mediaSubjectCategory

Title (Label)	Media Subject Category
Namespace	Iptc4xmpExt
Table:	AgentMedia
IRI	http://iptc.org/std/Iptc4xmpExt/2008-02-29/CVterm
Description	A term to describe the content of the image by a value from a controlled vocabulary.
Comments	Controlled vocabulary of subjects to support broad classification of media items. Terms from various controlled vocabularies may be used. AC-recommended vocabularies are preferred and MAY be unqualified literals (not a full URI). For terms from other vocabularies either a precise URI SHOULD be used, or, as long as all unqualified terms in all vocabularies are unique, metadata SHOULD provide the source vocabularies using the Subject Category Vocabulary term. The value SHOULD be a string, whose text can also be in the form of a URL. These guidelines on value format are less restrictive than is specified by the IPTC guidelines.
Examples	`herbarium sheet scan`
Type	string
Format	default

mediaSubjectCategoryIRI

Title (Label)	Media Subject Category IRI
Namespace	Iptc4xmpExt
Table:	AgentMedia
IRI	http://iptc.org/std/Iptc4xmpExt/2008-02-29/CVterm
Description	An IRI of a controlled vocabulary value for the subject category of a Media instance.
Type	string
Format	default

mediaSubjectCategoryVocabulary

Title (Label)	Media Subject Category Vocabulary
Namespace	ac
Table:	AgentMedia
IRI	http://rs.tdwg.org/ac/terms/subjectCategoryVocabulary
Description	Any vocabulary or formal classification from which terms in the Subject Category have been drawn.
Comments	The AC recommended vocabularies do not need to be cited here. There is no required linkage between individual Subject Category terms and the vocabulary; the mechanism is intended to support discovery of the normative URI for a term, but not guarantee it.
Type	string
Format	default

subjectPart

Title (Label)	SubjectPart
Namespace	ac
Table:	AgentMedia
IRI	http://rs.tdwg.org/ac/terms/subjectPart
Description	The portion or product of organism morphology, behaviour, environment, etc. that is either predominantly shown or particularly well exemplified by the media resource.
Examples	`head` `herbarium sheet` `habitat`
Type	string
Format	default

subjectOrientation

Title (Label)	SubjectOrientation
Namespace	ac
Table:	AgentMedia
IRI	http://rs.tdwg.org/ac/terms/subjectOrientation
Description	Specific orientation (= direction, view angle) of the subject represented in the media resource with respect to the acquisition device.
Examples	`frontal` `dorsal`
Type	string
Format	default

physicalSetting

Title (Label)	PhysicalSetting
Namespace	ac
Table:	AgentMedia
IRI	http://rs.tdwg.org/ac/terms/physicalSetting
Description	The setting of the content represented in media such as images, sounds, and movies if the provider deems them relevant. Constrained vocabulary of: `Natural` = Object in its natural setting of the object (e. g. living organisms in their natural environment); `Artificial` = Object in an artificial environment (e. g. living organisms in an artificial environment such as a zoo, garden, greenhouse, or laboratory); `Edited` = Human media editing of a natural setting or media acquisition with a separate media background such as a photographic backdrop.
Type	string
Format	default

ChronometricAgeMedia

Identifier: http://rs.tdwg.org/dwc/dwc-dp/chronometric-age-media

Description: A link establishing a chrono:ChronometricAge as content of a Media entity.

Relationships to Other Tables

Field	Target Table	Target Field	Required
mediaID	media	mediaID	Yes
chronometricAgeID	chronometric-age	chronometricAgeID	Yes

mediaID

Title (Label)	Media ID
Namespace	dwcdp
Table:	ChronometricAgeMedia
Description	An identifier for a Media instance.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

chronometricAgeID

Title (Label)	Chronometric Age ID
Namespace	chrono
Table:	ChronometricAgeMedia
IRI	http://rs.tdwg.org/chrono/terms/chronometricAgeID
Description	An identifier for a chrono:ChronometricAge.
Comments	Recommended best practice is to use a globally unique identifier.
Examples	`https://www.canadianarchaeology.ca/samples/70673`
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

mediaSubjectCategory

Title (Label)	Media Subject Category
Namespace	Iptc4xmpExt
Table:	ChronometricAgeMedia
IRI	http://iptc.org/std/Iptc4xmpExt/2008-02-29/CVterm
Description	A term to describe the content of the image by a value from a controlled vocabulary.
Comments	Controlled vocabulary of subjects to support broad classification of media items. Terms from various controlled vocabularies may be used. AC-recommended vocabularies are preferred and MAY be unqualified literals (not a full URI). For terms from other vocabularies either a precise URI SHOULD be used, or, as long as all unqualified terms in all vocabularies are unique, metadata SHOULD provide the source vocabularies using the Subject Category Vocabulary term. The value SHOULD be a string, whose text can also be in the form of a URL. These guidelines on value format are less restrictive than is specified by the IPTC guidelines.
Examples	`herbarium sheet scan`
Type	string
Format	default

mediaSubjectCategoryIRI

Title (Label)	Media Subject Category IRI
Namespace	Iptc4xmpExt
Table:	ChronometricAgeMedia
IRI	http://iptc.org/std/Iptc4xmpExt/2008-02-29/CVterm
Description	An IRI of a controlled vocabulary value for the subject category of a Media instance.
Type	string
Format	default

mediaSubjectCategoryVocabulary

Title (Label)	Media Subject Category Vocabulary
Namespace	ac
Table:	ChronometricAgeMedia
IRI	http://rs.tdwg.org/ac/terms/subjectCategoryVocabulary
Description	Any vocabulary or formal classification from which terms in the Subject Category have been drawn.
Comments	The AC recommended vocabularies do not need to be cited here. There is no required linkage between individual Subject Category terms and the vocabulary; the mechanism is intended to support discovery of the normative URI for a term, but not guarantee it.
Type	string
Format	default

subjectPart

Title (Label)	SubjectPart
Namespace	ac
Table:	ChronometricAgeMedia
IRI	http://rs.tdwg.org/ac/terms/subjectPart
Description	The portion or product of organism morphology, behaviour, environment, etc. that is either predominantly shown or particularly well exemplified by the media resource.
Examples	`head` `herbarium sheet` `habitat`
Type	string
Format	default

subjectOrientation

Title (Label)	SubjectOrientation
Namespace	ac
Table:	ChronometricAgeMedia
IRI	http://rs.tdwg.org/ac/terms/subjectOrientation
Description	Specific orientation (= direction, view angle) of the subject represented in the media resource with respect to the acquisition device.
Examples	`frontal` `dorsal`
Type	string
Format	default

physicalSetting

Title (Label)	PhysicalSetting
Namespace	ac
Table:	ChronometricAgeMedia
IRI	http://rs.tdwg.org/ac/terms/physicalSetting
Description	The setting of the content represented in media such as images, sounds, and movies if the provider deems them relevant. Constrained vocabulary of: `Natural` = Object in its natural setting of the object (e. g. living organisms in their natural environment); `Artificial` = Object in an artificial environment (e. g. living organisms in an artificial environment such as a zoo, garden, greenhouse, or laboratory); `Edited` = Human media editing of a natural setting or media acquisition with a separate media background such as a photographic backdrop.
Type	string
Format	default

EventMedia

Identifier: http://rs.tdwg.org/dwc/dwc-dp/event-media

Description: A link establishing a dwc:Event as content of a Media entity.

Relationships to Other Tables

Field	Target Table	Target Field	Required
mediaID	media	mediaID	Yes
eventID	event	eventID	Yes

mediaID

Title (Label)	Media ID
Namespace	dwcdp
Table:	EventMedia
Description	An identifier for a Media instance.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

eventID

Title (Label)	Event ID
Namespace	dwc
Table:	EventMedia
IRI	http://rs.tdwg.org/dwc/terms/eventID
Description	An identifier for a dwc:Event.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

mediaSubjectCategory

Title (Label)	Media Subject Category
Namespace	Iptc4xmpExt
Table:	EventMedia
IRI	http://iptc.org/std/Iptc4xmpExt/2008-02-29/CVterm
Description	A term to describe the content of the image by a value from a controlled vocabulary.
Comments	Controlled vocabulary of subjects to support broad classification of media items. Terms from various controlled vocabularies may be used. AC-recommended vocabularies are preferred and MAY be unqualified literals (not a full URI). For terms from other vocabularies either a precise URI SHOULD be used, or, as long as all unqualified terms in all vocabularies are unique, metadata SHOULD provide the source vocabularies using the Subject Category Vocabulary term. The value SHOULD be a string, whose text can also be in the form of a URL. These guidelines on value format are less restrictive than is specified by the IPTC guidelines.
Examples	`herbarium sheet scan`
Type	string
Format	default

mediaSubjectCategoryIRI

Title (Label)	Media Subject Category IRI
Namespace	Iptc4xmpExt
Table:	EventMedia
IRI	http://iptc.org/std/Iptc4xmpExt/2008-02-29/CVterm
Description	An IRI of a controlled vocabulary value for the subject category of a Media instance.
Type	string
Format	default

mediaSubjectCategoryVocabulary

Title (Label)	Media Subject Category Vocabulary
Namespace	ac
Table:	EventMedia
IRI	http://rs.tdwg.org/ac/terms/subjectCategoryVocabulary
Description	Any vocabulary or formal classification from which terms in the Subject Category have been drawn.
Comments	The AC recommended vocabularies do not need to be cited here. There is no required linkage between individual Subject Category terms and the vocabulary; the mechanism is intended to support discovery of the normative URI for a term, but not guarantee it.
Type	string
Format	default

subjectPart

Title (Label)	SubjectPart
Namespace	ac
Table:	EventMedia
IRI	http://rs.tdwg.org/ac/terms/subjectPart
Description	The portion or product of organism morphology, behaviour, environment, etc. that is either predominantly shown or particularly well exemplified by the media resource.
Examples	`head` `herbarium sheet` `habitat`
Type	string
Format	default

subjectOrientation

Title (Label)	SubjectOrientation
Namespace	ac
Table:	EventMedia
IRI	http://rs.tdwg.org/ac/terms/subjectOrientation
Description	Specific orientation (= direction, view angle) of the subject represented in the media resource with respect to the acquisition device.
Examples	`frontal` `dorsal`
Type	string
Format	default

physicalSetting

Title (Label)	PhysicalSetting
Namespace	ac
Table:	EventMedia
IRI	http://rs.tdwg.org/ac/terms/physicalSetting
Description	The setting of the content represented in media such as images, sounds, and movies if the provider deems them relevant. Constrained vocabulary of: `Natural` = Object in its natural setting of the object (e. g. living organisms in their natural environment); `Artificial` = Object in an artificial environment (e. g. living organisms in an artificial environment such as a zoo, garden, greenhouse, or laboratory); `Edited` = Human media editing of a natural setting or media acquisition with a separate media background such as a photographic backdrop.
Type	string
Format	default

GeologicalContextMedia

Identifier: http://rs.tdwg.org/dwc/dwc-dp/geological-context-media

Description: A link establishing a dwc:GeologicalContext as content of a Media entity.

Relationships to Other Tables

Field	Target Table	Target Field	Required
mediaID	media	mediaID	Yes
geologicalContextID	geological-context	geologicalContextID	Yes

mediaID

Title (Label)	Media ID
Namespace	dwcdp
Table:	GeologicalContextMedia
Description	An identifier for a Media instance.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

geologicalContextID

Title (Label)	Geological Context ID
Namespace	dwc
Table:	GeologicalContextMedia
IRI	http://rs.tdwg.org/dwc/terms/geologicalContextID
Description	An identifier for a dwc:GeologicalContext.
Comments	Recommended best practice is to use a globally unique identifier.
Examples	`https://opencontext.org/subjects/e54377f7-4452-4315-b676-40679b10c4d9`
Type	string
Constraints	{'required': True, 'unique': True}
Format	default

mediaSubjectCategory

Title (Label)	Media Subject Category
Namespace	Iptc4xmpExt
Table:	GeologicalContextMedia
IRI	http://iptc.org/std/Iptc4xmpExt/2008-02-29/CVterm
Description	A term to describe the content of the image by a value from a controlled vocabulary.
Comments	Controlled vocabulary of subjects to support broad classification of media items. Terms from various controlled vocabularies may be used. AC-recommended vocabularies are preferred and MAY be unqualified literals (not a full URI). For terms from other vocabularies either a precise URI SHOULD be used, or, as long as all unqualified terms in all vocabularies are unique, metadata SHOULD provide the source vocabularies using the Subject Category Vocabulary term. The value SHOULD be a string, whose text can also be in the form of a URL. These guidelines on value format are less restrictive than is specified by the IPTC guidelines.
Examples	`herbarium sheet scan`
Type	string
Format	default

mediaSubjectCategoryIRI

Title (Label)	Media Subject Category IRI
Namespace	Iptc4xmpExt
Table:	GeologicalContextMedia
IRI	http://iptc.org/std/Iptc4xmpExt/2008-02-29/CVterm
Description	An IRI of a controlled vocabulary value for the subject category of a Media instance.
Type	string
Format	default

mediaSubjectCategoryVocabulary

Title (Label)	Media Subject Category Vocabulary
Namespace	ac
Table:	GeologicalContextMedia
IRI	http://rs.tdwg.org/ac/terms/subjectCategoryVocabulary
Description	Any vocabulary or formal classification from which terms in the Subject Category have been drawn.
Comments	The AC recommended vocabularies do not need to be cited here. There is no required linkage between individual Subject Category terms and the vocabulary; the mechanism is intended to support discovery of the normative URI for a term, but not guarantee it.
Type	string
Format	default

subjectPart

Title (Label)	SubjectPart
Namespace	ac
Table:	GeologicalContextMedia
IRI	http://rs.tdwg.org/ac/terms/subjectPart
Description	The portion or product of organism morphology, behaviour, environment, etc. that is either predominantly shown or particularly well exemplified by the media resource.
Examples	`head` `herbarium sheet` `habitat`
Type	string
Format	default

subjectOrientation

Title (Label)	SubjectOrientation
Namespace	ac
Table:	GeologicalContextMedia
IRI	http://rs.tdwg.org/ac/terms/subjectOrientation
Description	Specific orientation (= direction, view angle) of the subject represented in the media resource with respect to the acquisition device.
Examples	`frontal` `dorsal`
Type	string
Format	default

physicalSetting

Title (Label)	PhysicalSetting
Namespace	ac
Table:	GeologicalContextMedia
IRI	http://rs.tdwg.org/ac/terms/physicalSetting
Description	The setting of the content represented in media such as images, sounds, and movies if the provider deems them relevant. Constrained vocabulary of: `Natural` = Object in its natural setting of the object (e. g. living organisms in their natural environment); `Artificial` = Object in an artificial environment (e. g. living organisms in an artificial environment such as a zoo, garden, greenhouse, or laboratory); `Edited` = Human media editing of a natural setting or media acquisition with a separate media background such as a photographic backdrop.
Type	string
Format	default

MaterialMedia

Identifier: http://rs.tdwg.org/dwc/dwc-dp/material-media

Description: A link establishing a dwc:MaterialEntity as content of a Media entity.

Relationships to Other Tables

Field	Target Table	Target Field	Required
mediaID	media	mediaID	Yes
materialEntityID	material	materialEntityID	Yes

mediaID

Title (Label)	Media ID
Namespace	dwcdp
Table:	MaterialMedia
Description	An identifier for a Media instance.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

materialEntityID

Title (Label)	Material Entity ID
Namespace	dwc
Table:	MaterialMedia
IRI	http://rs.tdwg.org/dwc/terms/materialEntityID
Description	An identifier for a dwc:MaterialEntity.
Comments	Values of dwc:materialEntityID are intended to uniquely and persistently identify a particular dwc:MaterialEntity within some context. Examples of context include a particular sample collection, an organization, or the worldwide scale. Recommended best practice is to use a persistent, globally unique identifier. The identifier is bound to a physical object (a dwc:MaterialEntity) as opposed to a particular digital record (representation) of that physical object.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

mediaSubjectCategory

Title (Label)	Media Subject Category
Namespace	Iptc4xmpExt
Table:	MaterialMedia
IRI	http://iptc.org/std/Iptc4xmpExt/2008-02-29/CVterm
Description	A term to describe the content of the image by a value from a controlled vocabulary.
Comments	Controlled vocabulary of subjects to support broad classification of media items. Terms from various controlled vocabularies may be used. AC-recommended vocabularies are preferred and MAY be unqualified literals (not a full URI). For terms from other vocabularies either a precise URI SHOULD be used, or, as long as all unqualified terms in all vocabularies are unique, metadata SHOULD provide the source vocabularies using the Subject Category Vocabulary term. The value SHOULD be a string, whose text can also be in the form of a URL. These guidelines on value format are less restrictive than is specified by the IPTC guidelines.
Examples	`herbarium sheet scan`
Type	string
Format	default

mediaSubjectCategoryIRI

Title (Label)	Media Subject Category IRI
Namespace	Iptc4xmpExt
Table:	MaterialMedia
IRI	http://iptc.org/std/Iptc4xmpExt/2008-02-29/CVterm
Description	An IRI of a controlled vocabulary value for the subject category of a Media instance.
Type	string
Format	default

mediaSubjectCategoryVocabulary

Title (Label)	Media Subject Category Vocabulary
Namespace	ac
Table:	MaterialMedia
IRI	http://rs.tdwg.org/ac/terms/subjectCategoryVocabulary
Description	Any vocabulary or formal classification from which terms in the Subject Category have been drawn.
Comments	The AC recommended vocabularies do not need to be cited here. There is no required linkage between individual Subject Category terms and the vocabulary; the mechanism is intended to support discovery of the normative URI for a term, but not guarantee it.
Type	string
Format	default

subjectPart

Title (Label)	SubjectPart
Namespace	ac
Table:	MaterialMedia
IRI	http://rs.tdwg.org/ac/terms/subjectPart
Description	The portion or product of organism morphology, behaviour, environment, etc. that is either predominantly shown or particularly well exemplified by the media resource.
Examples	`head` `herbarium sheet` `habitat`
Type	string
Format	default

subjectOrientation

Title (Label)	SubjectOrientation
Namespace	ac
Table:	MaterialMedia
IRI	http://rs.tdwg.org/ac/terms/subjectOrientation
Description	Specific orientation (= direction, view angle) of the subject represented in the media resource with respect to the acquisition device.
Examples	`frontal` `dorsal`
Type	string
Format	default

physicalSetting

Title (Label)	PhysicalSetting
Namespace	ac
Table:	MaterialMedia
IRI	http://rs.tdwg.org/ac/terms/physicalSetting
Description	The setting of the content represented in media such as images, sounds, and movies if the provider deems them relevant. Constrained vocabulary of: `Natural` = Object in its natural setting of the object (e. g. living organisms in their natural environment); `Artificial` = Object in an artificial environment (e. g. living organisms in an artificial environment such as a zoo, garden, greenhouse, or laboratory); `Edited` = Human media editing of a natural setting or media acquisition with a separate media background such as a photographic backdrop.
Type	string
Format	default

OccurrenceMedia

Identifier: http://rs.tdwg.org/dwc/dwc-dp/occurrence-media

Description: A link establishing a dwc:Occurrence as content of a Media entity.

Relationships to Other Tables

Field	Target Table	Target Field	Required
mediaID	media	mediaID	Yes
occurrenceID	occurrence	occurrenceID	Yes

mediaID

Title (Label)	Media ID
Namespace	dwcdp
Table:	OccurrenceMedia
Description	An identifier for a Media instance.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

occurrenceID

Title (Label)	Occurrence ID
Namespace	dwc
Table:	OccurrenceMedia
IRI	http://rs.tdwg.org/dwc/terms/occurrenceID
Description	An identifier for a dwc:Occurrence.
Comments	Recommended best practice is to use a persistent, globally unique identifier. In the absence of a persistent global unique identifier, construct one from a combination of identifiers in the record that will most closely make a dwc:occurrenceID globally unique.
Examples	`http://arctos.database.museum/guid/MSB:Mamm:233627`
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

mediaSubjectCategory

Title (Label)	Media Subject Category
Namespace	Iptc4xmpExt
Table:	OccurrenceMedia
IRI	http://iptc.org/std/Iptc4xmpExt/2008-02-29/CVterm
Description	A term to describe the content of the image by a value from a controlled vocabulary.
Comments	Controlled vocabulary of subjects to support broad classification of media items. Terms from various controlled vocabularies may be used. AC-recommended vocabularies are preferred and MAY be unqualified literals (not a full URI). For terms from other vocabularies either a precise URI SHOULD be used, or, as long as all unqualified terms in all vocabularies are unique, metadata SHOULD provide the source vocabularies using the Subject Category Vocabulary term. The value SHOULD be a string, whose text can also be in the form of a URL. These guidelines on value format are less restrictive than is specified by the IPTC guidelines.
Examples	`herbarium sheet scan`
Type	string
Format	default

mediaSubjectCategoryIRI

Title (Label)	Media Subject Category IRI
Namespace	Iptc4xmpExt
Table:	OccurrenceMedia
IRI	http://iptc.org/std/Iptc4xmpExt/2008-02-29/CVterm
Description	An IRI of a controlled vocabulary value for the subject category of a Media instance.
Type	string
Format	default

mediaSubjectCategoryVocabulary

Title (Label)	Media Subject Category Vocabulary
Namespace	ac
Table:	OccurrenceMedia
IRI	http://rs.tdwg.org/ac/terms/subjectCategoryVocabulary
Description	Any vocabulary or formal classification from which terms in the Subject Category have been drawn.
Comments	The AC recommended vocabularies do not need to be cited here. There is no required linkage between individual Subject Category terms and the vocabulary; the mechanism is intended to support discovery of the normative URI for a term, but not guarantee it.
Type	string
Format	default

subjectPart

Title (Label)	SubjectPart
Namespace	ac
Table:	OccurrenceMedia
IRI	http://rs.tdwg.org/ac/terms/subjectPart
Description	The portion or product of organism morphology, behaviour, environment, etc. that is either predominantly shown or particularly well exemplified by the media resource.
Examples	`head` `herbarium sheet` `habitat`
Type	string
Format	default

subjectOrientation

Title (Label)	SubjectOrientation
Namespace	ac
Table:	OccurrenceMedia
IRI	http://rs.tdwg.org/ac/terms/subjectOrientation
Description	Specific orientation (= direction, view angle) of the subject represented in the media resource with respect to the acquisition device.
Examples	`frontal` `dorsal`
Type	string
Format	default

physicalSetting

Title (Label)	PhysicalSetting
Namespace	ac
Table:	OccurrenceMedia
IRI	http://rs.tdwg.org/ac/terms/physicalSetting
Description	The setting of the content represented in media such as images, sounds, and movies if the provider deems them relevant. Constrained vocabulary of: `Natural` = Object in its natural setting of the object (e. g. living organisms in their natural environment); `Artificial` = Object in an artificial environment (e. g. living organisms in an artificial environment such as a zoo, garden, greenhouse, or laboratory); `Edited` = Human media editing of a natural setting or media acquisition with a separate media background such as a photographic backdrop.
Type	string
Format	default

OrganismInteractionMedia

Identifier: http://rs.tdwg.org/dwc/dwc-dp/organism-interaction-media

Description: A link establishing an OrganismInteraction as content of a Media entity.

Relationships to Other Tables

Field	Target Table	Target Field	Required
mediaID	media	mediaID	Yes
organismInteractionID	organism-interaction	organismInteractionID	Yes

mediaID

Title (Label)	Media ID
Namespace	dwcdp
Table:	OrganismInteractionMedia
Description	An identifier for a Media instance.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

organismInteractionID

Title (Label)	Organism Interaction ID
Namespace	dwcdp
Table:	OrganismInteractionMedia
Description	An identifier for an OrganismInteraction.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

mediaSubjectCategory

Title (Label)	Media Subject Category
Namespace	Iptc4xmpExt
Table:	OrganismInteractionMedia
IRI	http://iptc.org/std/Iptc4xmpExt/2008-02-29/CVterm
Description	A term to describe the content of the image by a value from a controlled vocabulary.
Comments	Controlled vocabulary of subjects to support broad classification of media items. Terms from various controlled vocabularies may be used. AC-recommended vocabularies are preferred and MAY be unqualified literals (not a full URI). For terms from other vocabularies either a precise URI SHOULD be used, or, as long as all unqualified terms in all vocabularies are unique, metadata SHOULD provide the source vocabularies using the Subject Category Vocabulary term. The value SHOULD be a string, whose text can also be in the form of a URL. These guidelines on value format are less restrictive than is specified by the IPTC guidelines.
Examples	`herbarium sheet scan`
Type	string
Format	default

mediaSubjectCategoryIRI

Title (Label)	Media Subject Category IRI
Namespace	Iptc4xmpExt
Table:	OrganismInteractionMedia
IRI	http://iptc.org/std/Iptc4xmpExt/2008-02-29/CVterm
Description	An IRI of a controlled vocabulary value for the subject category of a Media instance.
Type	string
Format	default

mediaSubjectCategoryVocabulary

Title (Label)	Media Subject Category Vocabulary
Namespace	ac
Table:	OrganismInteractionMedia
IRI	http://rs.tdwg.org/ac/terms/subjectCategoryVocabulary
Description	Any vocabulary or formal classification from which terms in the Subject Category have been drawn.
Comments	The AC recommended vocabularies do not need to be cited here. There is no required linkage between individual Subject Category terms and the vocabulary; the mechanism is intended to support discovery of the normative URI for a term, but not guarantee it.
Type	string
Format	default

subjectPart

Title (Label)	SubjectPart
Namespace	ac
Table:	OrganismInteractionMedia
IRI	http://rs.tdwg.org/ac/terms/subjectPart
Description	The portion or product of organism morphology, behaviour, environment, etc. that is either predominantly shown or particularly well exemplified by the media resource.
Examples	`head` `herbarium sheet` `habitat`
Type	string
Format	default

subjectOrientation

Title (Label)	SubjectOrientation
Namespace	ac
Table:	OrganismInteractionMedia
IRI	http://rs.tdwg.org/ac/terms/subjectOrientation
Description	Specific orientation (= direction, view angle) of the subject represented in the media resource with respect to the acquisition device.
Examples	`frontal` `dorsal`
Type	string
Format	default

physicalSetting

Title (Label)	PhysicalSetting
Namespace	ac
Table:	OrganismInteractionMedia
IRI	http://rs.tdwg.org/ac/terms/physicalSetting
Description	The setting of the content represented in media such as images, sounds, and movies if the provider deems them relevant. Constrained vocabulary of: `Natural` = Object in its natural setting of the object (e. g. living organisms in their natural environment); `Artificial` = Object in an artificial environment (e. g. living organisms in an artificial environment such as a zoo, garden, greenhouse, or laboratory); `Edited` = Human media editing of a natural setting or media acquisition with a separate media background such as a photographic backdrop.
Type	string
Format	default

PhylogeneticTreeMedia

Identifier: http://rs.tdwg.org/dwc/dwc-dp/phylogenetic-tree-media

Description: A link establishing a PhylogeneticTree as content of a Media entity.

Relationships to Other Tables

Field	Target Table	Target Field	Required
mediaID	media	mediaID	Yes
phylogeneticTreeID	phylogenetic-tree	phylogeneticTreeID	Yes

mediaID

Title (Label)	Media ID
Namespace	dwcdp
Table:	PhylogeneticTreeMedia
Description	An identifier for a Media instance.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

phylogeneticTreeID

Title (Label)	Phylogenetic Tree ID
Namespace	dwcdp
Table:	PhylogeneticTreeMedia
Description	An identifier for a PhylogeneticTree.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

mediaSubjectCategory

Title (Label)	Media Subject Category
Namespace	Iptc4xmpExt
Table:	PhylogeneticTreeMedia
IRI	http://iptc.org/std/Iptc4xmpExt/2008-02-29/CVterm
Description	A term to describe the content of the image by a value from a controlled vocabulary.
Comments	Controlled vocabulary of subjects to support broad classification of media items. Terms from various controlled vocabularies may be used. AC-recommended vocabularies are preferred and MAY be unqualified literals (not a full URI). For terms from other vocabularies either a precise URI SHOULD be used, or, as long as all unqualified terms in all vocabularies are unique, metadata SHOULD provide the source vocabularies using the Subject Category Vocabulary term. The value SHOULD be a string, whose text can also be in the form of a URL. These guidelines on value format are less restrictive than is specified by the IPTC guidelines.
Examples	`herbarium sheet scan`
Type	string
Format	default

mediaSubjectCategoryIRI

Title (Label)	Media Subject Category IRI
Namespace	Iptc4xmpExt
Table:	PhylogeneticTreeMedia
IRI	http://iptc.org/std/Iptc4xmpExt/2008-02-29/CVterm
Description	An IRI of a controlled vocabulary value for the subject category of a Media instance.
Type	string
Format	default

mediaSubjectCategoryVocabulary

Title (Label)	Media Subject Category Vocabulary
Namespace	ac
Table:	PhylogeneticTreeMedia
IRI	http://rs.tdwg.org/ac/terms/subjectCategoryVocabulary
Description	Any vocabulary or formal classification from which terms in the Subject Category have been drawn.
Comments	The AC recommended vocabularies do not need to be cited here. There is no required linkage between individual Subject Category terms and the vocabulary; the mechanism is intended to support discovery of the normative URI for a term, but not guarantee it.
Type	string
Format	default

subjectPart

Title (Label)	SubjectPart
Namespace	ac
Table:	PhylogeneticTreeMedia
IRI	http://rs.tdwg.org/ac/terms/subjectPart
Description	The portion or product of organism morphology, behaviour, environment, etc. that is either predominantly shown or particularly well exemplified by the media resource.
Examples	`head` `herbarium sheet` `habitat`
Type	string
Format	default

subjectOrientation

Title (Label)	SubjectOrientation
Namespace	ac
Table:	PhylogeneticTreeMedia
IRI	http://rs.tdwg.org/ac/terms/subjectOrientation
Description	Specific orientation (= direction, view angle) of the subject represented in the media resource with respect to the acquisition device.
Examples	`frontal` `dorsal`
Type	string
Format	default

physicalSetting

Title (Label)	PhysicalSetting
Namespace	ac
Table:	PhylogeneticTreeMedia
IRI	http://rs.tdwg.org/ac/terms/physicalSetting
Description	The setting of the content represented in media such as images, sounds, and movies if the provider deems them relevant. Constrained vocabulary of: `Natural` = Object in its natural setting of the object (e. g. living organisms in their natural environment); `Artificial` = Object in an artificial environment (e. g. living organisms in an artificial environment such as a zoo, garden, greenhouse, or laboratory); `Edited` = Human media editing of a natural setting or media acquisition with a separate media background such as a photographic backdrop.
Type	string
Format	default

Protocol

Identifier: http://rs.tdwg.org/dwc/dwc-dp/protocol

Description: A method used during an action.

Examples:

`a pitfall trap method for sampling ground-dwelling arthropods`

`a point-radius georeferencing method`

`a linear regression model to estimate body mass from skeletal measurements`

`a Bayesian phylogenetic inference method`

protocolID

Title (Label)	Protocol ID
Namespace	dwcdp
Table:	Protocol
Description	An identifier for a Protocol.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': True}
Format	default

protocolType

Title (Label)	Protocol Type
Namespace	dwcdp
Table:	Protocol
Description	A category that best matches the nature of a Protocol.
Comments	Recommended best practice is to use a controlled vocabulary.
Examples	`measurement` `georeference` `chronometric age` `chronometric age conversion` `sampling effort`
Type	string
Format	default

protocolTypeIRI

Title (Label)	Protocol Type IRI
Namespace	dwcdp
Table:	Protocol
Description	An IRI of a controlled vocabulary value for the type of Protocol.
Comments	Recommended best practice is to use an IRI for a term in a controlled vocabulary.
Type	string
Format	default

protocolTypeVocabulary

Title (Label)	Protocol Type Vocabulary
Namespace	dwcdp
Table:	Protocol
Description	A reference to a controlled vocabulary in which the definition of a value in protocolType is given.
Type	string
Format	default

protocolName

Title (Label)	Protocol Name
Namespace	dwcdp
Table:	Protocol
Description	A name of a Protocol.
Examples	`ad hoc observation` `bottom trawl` `point count` `UV light trap`
Type	string
Format	default

protocolDescription

Title (Label)	Protocol Description
Namespace	dwcdp
Table:	Protocol
Description	A description of a Protocol.
Type	string
Format	default

protocolReference

Title (Label)	Protocol Reference
Namespace	dcterms
Table:	Protocol
IRI	http://purl.org/dc/terms/bibliographicCitation
Description	A bibliographic reference in which a Protocol is mentioned.
Type	string
Format	default

protocolRemarks

Title (Label)	Protocol Remarks
Namespace	dwcdp
Table:	Protocol
Description	Comments or notes about a Protocol.
Type	string
Format	default

ChronometricAgeProtocol

Identifier: http://rs.tdwg.org/dwc/dwc-dp/chronometric-age-protocol

Description: A link establishing a Protocol used in the determination of a chrono:ChronometricAge.

Relationships to Other Tables

Field	Target Table	Target Field	Required
protocolID	protocol	protocolID	Yes
chronometricAgeID	chronometric-age	chronometricAgeID	Yes

protocolID

Title (Label)	Protocol ID
Namespace	dwcdp
Table:	ChronometricAgeProtocol
Description	An identifier for a Protocol.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

chronometricAgeID

Title (Label)	Chronometric Age ID
Namespace	chrono
Table:	ChronometricAgeProtocol
IRI	http://rs.tdwg.org/chrono/terms/chronometricAgeID
Description	An identifier for a chrono:ChronometricAge.
Comments	Recommended best practice is to use a globally unique identifier.
Examples	`https://www.canadianarchaeology.ca/samples/70673`
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

EventProtocol

Identifier: http://rs.tdwg.org/dwc/dwc-dp/event-protocol

Description: A link establishing a Protocol used in a dwc:Event.

Relationships to Other Tables

Field	Target Table	Target Field	Required
protocolID	protocol	protocolID	Yes
eventID	event	eventID	Yes

protocolID

Title (Label)	Protocol ID
Namespace	dwcdp
Table:	EventProtocol
Description	An identifier for a Protocol.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

eventID

Title (Label)	Event ID
Namespace	dwc
Table:	EventProtocol
IRI	http://rs.tdwg.org/dwc/terms/eventID
Description	An identifier for a dwc:Event.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

MaterialProtocol

Identifier: http://rs.tdwg.org/dwc/dwc-dp/material-protocol

Description: A link establishing a Protocol used in the treatment of a dwc:MaterialEntity.

Relationships to Other Tables

Field	Target Table	Target Field	Required
protocolID	protocol	protocolID	Yes
materialEntityID	material	materialEntityID	Yes

protocolID

Title (Label)	Protocol ID
Namespace	dwcdp
Table:	MaterialProtocol
Description	An identifier for a Protocol.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

materialEntityID

Title (Label)	Material Entity ID
Namespace	dwc
Table:	MaterialProtocol
IRI	http://rs.tdwg.org/dwc/terms/materialEntityID
Description	An identifier for a dwc:MaterialEntity.
Comments	Values of dwc:materialEntityID are intended to uniquely and persistently identify a particular dwc:MaterialEntity within some context. Examples of context include a particular sample collection, an organization, or the worldwide scale. Recommended best practice is to use a persistent, globally unique identifier. The identifier is bound to a physical object (a dwc:MaterialEntity) as opposed to a particular digital record (representation) of that physical object.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

OccurrenceProtocol

Identifier: http://rs.tdwg.org/dwc/dwc-dp/occurrence-protocol

Description: A link establishing a Protocol used in the determination of a dwc:Occurrence.

Relationships to Other Tables

Field	Target Table	Target Field	Required
protocolID	protocol	protocolID	Yes
occurrenceID	occurrence	occurrenceID	Yes

protocolID

Title (Label)	Protocol ID
Namespace	dwcdp
Table:	OccurrenceProtocol
Description	An identifier for a Protocol.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

occurrenceID

Title (Label)	Occurrence ID
Namespace	dwc
Table:	OccurrenceProtocol
IRI	http://rs.tdwg.org/dwc/terms/occurrenceID
Description	An identifier for a dwc:Occurrence.
Comments	Recommended best practice is to use a persistent, globally unique identifier. In the absence of a persistent global unique identifier, construct one from a combination of identifiers in the record that will most closely make a dwc:occurrenceID globally unique.
Examples	`http://arctos.database.museum/guid/MSB:Mamm:233627`
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

PhylogeneticTreeProtocol

Identifier: http://rs.tdwg.org/dwc/dwc-dp/phylogenetic-tree-protocol

Description: A link establishing a Protocol used in the determination of a PhylogeneticTree.

Relationships to Other Tables

Field	Target Table	Target Field	Required
protocolID	protocol	protocolID	Yes
phylogeneticTreeID	phylogenetic-tree	phylogeneticTreeID	Yes

protocolID

Title (Label)	Protocol ID
Namespace	dwcdp
Table:	PhylogeneticTreeProtocol
Description	An identifier for a Protocol.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

phylogeneticTreeID

Title (Label)	Phylogenetic Tree ID
Namespace	dwcdp
Table:	PhylogeneticTreeProtocol
Description	An identifier for a PhylogeneticTree.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

SurveyProtocol

Identifier: http://rs.tdwg.org/dwc/dwc-dp/survey-protocol

Description: A link establishing a Protocol used in a Survey.

Relationships to Other Tables

Field	Target Table	Target Field	Required
protocolID	protocol	protocolID	Yes
surveyID	survey	surveyID	Yes

protocolID

Title (Label)	Protocol ID
Namespace	dwcdp
Table:	SurveyProtocol
Description	An identifier for a Protocol.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

surveyID

Title (Label)	Survey ID
Namespace	dwcdp
Table:	SurveyProtocol
Description	An identifier for a Survey.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

Reference

Identifier: http://rs.tdwg.org/dwc/dwc-dp/reference

Description: A bibliographic reference in which an entity is mentioned.

Examples:

`a peer-reviewed journal article describing a taxonomic revision`

`a page in a field notebook containing an original drawing of a fossil in context`

`a nucleotide sequence database entry for a barcoded specimen`

`an online dataset documenting organism occurrences in a region`

Relationships to Other Tables

Field	Target Table	Target Field	Required
parentReferenceID	reference	referenceID	No
creatorID	agent	agentID	No
publisherID	agent	agentID	No

referenceID

Title (Label)	Reference ID
Namespace	dwcdp
Table:	Reference
Description	An identifier for a Reference.
Comments	Recommended best practice is to use a globally unique identifier.
Examples	`doi:10.15156/BIO/3301231`
Type	string
Constraints	{'required': True, 'unique': True}
Format	default

parentReferenceID

Title (Label)	Parent Reference ID
Namespace	dwcdp
Table:	Reference
Description	An identifier for a Reference that includes this Reference.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Format	default

referenceType

Title (Label)	Reference Type
Namespace	dwcdp
Table:	Reference
Description	A category that best matches the nature of a Reference.
Comments	Recommended best practice is to use a controlled vocabulary.
Examples	`book` `thesis` `report` `field notes` `standard` `chapter` `journal article` `unpublished manuscript` `conference paper` `website` `blog post` `section` `figure` `table` `page` `dataset` `map` `audiovisual material` `software` `legal document` `nucleotide sequence library`
Type	string
Format	default

bibliographicCitation

Title (Label)	Bibliographic Citation
Namespace	dcterms
Table:	Reference
IRI	http://purl.org/dc/terms/bibliographicCitation
Description	A bibliographic reference for the resource.
Comments	From Dublin Core, 'Recommended practice is to include sufficient bibliographic detail to identify the resource as unambiguously as possible.' The intended usage of this term in Darwin Core is to provide the preferred way to cite the resource itself. Note that the intended usage of dcterms:references in Darwin Core, by contrast, is to point to the definitive source representation of the resource, if one is available.
Examples	`Museum of Vertebrate Zoology, UC Berkeley. MVZ Mammal Collection (Arctos). Record ID: http://arctos.database.museum/guid/MVZ:Mamm:165861?seid=101356. Source: http://ipt.vertnet.org:8080/ipt/resource.do?r=mvz_mammal.` (Occurrence example) `https://www.gbif.org/species/2439608 Source: GBIF Taxonomic Backbone` (Taxon example) `Rand, K.M., Logerwell, E.A. The first demersal trawl survey of benthic fish and invertebrates in the Beaufort Sea since the late 1970s. Polar Biol 34, 475–488 (2011). https://doi.org/10.1007/s00300-010-0900-2` (Event example)
Type	string
Format	default

title

Title (Label)	Title
Namespace	dc
Table:	Reference
IRI	http://purl.org/dc/elements/1.1/title
Description	A name given to the resource.
Comments	Typically, a Title will be a name by which the resource is formally known.
Examples	`The first demersal trawl survey of benthic fish and invertebrates in the Beaufort Sea since the late 1970s`
Type	string
Format	default

issued

Title (Label)	Issued
Namespace	dcterms
Table:	Reference
IRI	http://purl.org/dc/terms/issued
Description	Date of formal issuance of the resource.
Comments	Recommended best practice is to use a date that conforms to ISO 8601-1:2019.
Examples	`2011` `2025-04-24`
Type	string
Format	default

identifier

Title (Label)	Identifier
Namespace	dcterms
Table:	Reference
IRI	http://purl.org/dc/terms/identifier
Description	An unambiguous reference to a resource within a given context.
Comments	Recommended best practice is to identify the resource by means of a string conforming to an identification system. Examples include International Standard Book Number (ISBN), Digital Object Identifier (DOI), and Uniform Resource Name (URN). Persistent identifiers should be provided as HTTP URIs.
Examples	`https://doi.org/10.1007/s00300-010-0900-2`
Type	string
Format	default

creator

Title (Label)	Creator
Namespace	dc
Table:	Reference
IRI	http://purl.org/dc/elements/1.1/creator
Description	An entity primarily responsible for making the resource.
Comments	Examples of a Creator include a person, an organization, or a service. Typically, the name of a Creator should be used to indicate the entity.
Examples	`Linnaeus, Carl`
Type	string
Format	default

creatorID

Title (Label)	Creator ID
Namespace	dcterms
Table:	Reference
IRI	http://purl.org/dc/terms/creator
Description	An entity primarily responsible for making the resource.
Comments	Examples of a Creator include a person, an organization, or a service. Typically, the name of a Creator should be used to indicate the entity.
Examples	`http://viaf.org/viaf/71397889`
Type	string
Format	default

publisher

Title (Label)	Publisher
Namespace	dc
Table:	Reference
IRI	http://purl.org/dc/elements/1.1/publisher
Description	An entity responsible for making the resource available.
Comments	Examples of a Publisher include a person, an organization, or a service. Typically, the name of a Publisher should be used to indicate the entity.
Examples	`Oxford University Press`
Type	string
Format	default

publisherID

Title (Label)	Publisher ID
Namespace	dcterms
Table:	Reference
IRI	http://purl.org/dc/terms/publisher
Description	An entity responsible for making the resource available.
Comments	Examples of a Publisher include a person, an organization, or a service. Typically, the name of a Publisher should be used to indicate the entity.
Examples	`http://id.loc.gov/authorities/names/n80001888`
Type	string
Format	default

pagination

Title (Label)	Pagination
Namespace	schema
Table:	Reference
IRI	https://schema.org/pagination
Description	Any description of pages that is not separated into pageStart and pageEnd.
Examples	`42` `42–47` `42, 45, 47–49` `xii–xv`
Type	string
Format	default

isPeerReviewed

Title (Label)	Is Peer Reviewed
Namespace	dwcdp
Table:	Reference
Description	An indication of whether a Reference was peer reviewed.
Examples	`true` `false`
Type	boolean
Format	default

referenceRemarks

Title (Label)	Reference Remarks
Namespace	dwcdp
Table:	Reference
Description	Comments or notes about a Reference.
Type	string
Format	default

ChronometricAgeReference

Identifier: http://rs.tdwg.org/dwc/dwc-dp/chronometric-age-reference

Description: A bibliographic reference in which a chrono:ChronometricAge is mentioned.

Relationships to Other Tables

Field	Target Table	Target Field	Required
referenceID	reference	referenceID	Yes
chronometricAgeID	chronometric-age	chronometricAgeID	Yes

referenceID

Title (Label)	Reference ID
Namespace	dwcdp
Table:	ChronometricAgeReference
Description	An identifier for a Reference.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

chronometricAgeID

Title (Label)	Chronometric Age ID
Namespace	chrono
Table:	ChronometricAgeReference
IRI	http://rs.tdwg.org/chrono/terms/chronometricAgeID
Description	An identifier for a chrono:ChronometricAge.
Comments	Recommended best practice is to use a globally unique identifier.
Examples	`https://www.canadianarchaeology.ca/samples/70673`
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

EventReference

Identifier: http://rs.tdwg.org/dwc/dwc-dp/event-reference

Description: A bibliographic reference in which a dwc:Event is mentioned.

Relationships to Other Tables

Field	Target Table	Target Field	Required
referenceID	reference	referenceID	Yes
eventID	event	eventID	Yes

referenceID

Title (Label)	Reference ID
Namespace	dwcdp
Table:	EventReference
Description	An identifier for a Reference.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

eventID

Title (Label)	Event ID
Namespace	dwc
Table:	EventReference
IRI	http://rs.tdwg.org/dwc/terms/eventID
Description	An identifier for a dwc:Event.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': True}
Format	default

MaterialReference

Identifier: http://rs.tdwg.org/dwc/dwc-dp/material-reference

Description: A bibliographic reference in which a dwc:MaterialEntity is mentioned.

Relationships to Other Tables

Field	Target Table	Target Field	Required
referenceID	reference	referenceID	Yes
materialEntityID	material	materialEntityID	Yes

referenceID

Title (Label)	Reference ID
Namespace	dwcdp
Table:	MaterialReference
Description	An identifier for a Reference.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

materialEntityID

Title (Label)	Material Entity ID
Namespace	dwc
Table:	MaterialReference
IRI	http://rs.tdwg.org/dwc/terms/materialEntityID
Description	An identifier for a dwc:MaterialEntity.
Comments	Values of dwc:materialEntityID are intended to uniquely and persistently identify a particular dwc:MaterialEntity within some context. Examples of context include a particular sample collection, an organization, or the worldwide scale. Recommended best practice is to use a persistent, globally unique identifier. The identifier is bound to a physical object (a dwc:MaterialEntity) as opposed to a particular digital record (representation) of that physical object.
Type	string
Constraints	{'required': True, 'unique': True}
Format	default

MolecularProtocolReference

Identifier: http://rs.tdwg.org/dwc/dwc-dp/molecular-protocol-reference

Description: A bibliographic reference in which a MolecularProtocol is mentioned.

Relationships to Other Tables

Field	Target Table	Target Field	Required
referenceID	reference	referenceID	Yes
molecularProtocolID	molecular-protocol	molecularProtocolID	Yes

referenceID

Title (Label)	Reference ID
Namespace	dwcdp
Table:	MolecularProtocolReference
Description	An identifier for a Reference.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

molecularProtocolID

Title (Label)	Molecular Protocol ID
Namespace	dwcdp
Table:	MolecularProtocolReference
Description	An identifier for a MolecularProtocol.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

OccurrenceReference

Identifier: http://rs.tdwg.org/dwc/dwc-dp/occurrence-reference

Description: A bibliographic reference in which a dwc:Occurrence is mentioned.

Relationships to Other Tables

Field	Target Table	Target Field	Required
referenceID	reference	referenceID	Yes
occurrenceID	occurrence	occurrenceID	Yes

referenceID

Title (Label)	Reference ID
Namespace	dwcdp
Table:	OccurrenceReference
Description	An identifier for a Reference.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

occurrenceID

Title (Label)	Occurrence ID
Namespace	dwc
Table:	OccurrenceReference
IRI	http://rs.tdwg.org/dwc/terms/occurrenceID
Description	An identifier for a dwc:Occurrence.
Comments	Recommended best practice is to use a persistent, globally unique identifier. In the absence of a persistent global unique identifier, construct one from a combination of identifiers in the record that will most closely make a dwc:occurrenceID globally unique.
Examples	`http://arctos.database.museum/guid/MSB:Mamm:233627`
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

ProtocolReference

Identifier: http://rs.tdwg.org/dwc/dwc-dp/protocol-reference

Description: A bibliographic reference in which a Protocol is mentioned.

Relationships to Other Tables

Field	Target Table	Target Field	Required
referenceID	reference	referenceID	Yes
protocolID	protocol	protocolID	Yes

referenceID

Title (Label)	Reference ID
Namespace	dwcdp
Table:	ProtocolReference
Description	An identifier for a Reference.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

protocolID

Title (Label)	Protocol ID
Namespace	dwcdp
Table:	ProtocolReference
Description	An identifier for a Protocol.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

OrganismInteractionReference

Identifier: http://rs.tdwg.org/dwc/dwc-dp/organism-interaction-reference

Description: A bibliographic reference in which an OrganismInteraction is mentioned.

Relationships to Other Tables

Field	Target Table	Target Field	Required
referenceID	reference	referenceID	Yes
organismInteractionID	organism-interaction	organismInteractionID	Yes

referenceID

Title (Label)	Reference ID
Namespace	dwcdp
Table:	OrganismInteractionReference
Description	An identifier for a Reference.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

organismInteractionID

Title (Label)	Organism Interaction ID
Namespace	dwcdp
Table:	OrganismInteractionReference
Description	An identifier for an OrganismInteraction.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

PhylogeneticTreeReference

Identifier: http://rs.tdwg.org/dwc/dwc-dp/phylogenetic-tree-reference

Description: A bibliographic reference in which a PhylogeneticTree is mentioned.

Relationships to Other Tables

Field	Target Table	Target Field	Required
referenceID	reference	referenceID	Yes
phylogeneticTreeID	phylogenetic-tree	phylogeneticTreeID	Yes

referenceID

Title (Label)	Reference ID
Namespace	dwcdp
Table:	PhylogeneticTreeReference
Description	An identifier for a Reference.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

phylogeneticTreeID

Title (Label)	Phylogenetic Tree ID
Namespace	dwcdp
Table:	PhylogeneticTreeReference
Description	An identifier for a PhylogeneticTree.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

SurveyReference

Identifier: http://rs.tdwg.org/dwc/dwc-dp/survey-reference

Description: A bibliographic reference in which a Survey is mentioned.

Relationships to Other Tables

Field	Target Table	Target Field	Required
referenceID	reference	referenceID	Yes
surveyID	survey	surveyID	Yes

referenceID

Title (Label)	Reference ID
Namespace	dwcdp
Table:	SurveyReference
Description	An identifier for a Reference.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

surveyID

Title (Label)	Survey ID
Namespace	dwcdp
Table:	SurveyReference
Description	An identifier for a Survey.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

ChronometricAgeAssertion

Identifier: http://rs.tdwg.org/dwc/dwc-dp/chronometric-age-assertion

Description: An Assertion made by an Agent about a chrono:ChronometricAge.

Relationships to Other Tables

Field	Target Table	Target Field	Required
chronometricAgeID	chronometric-age	chronometricAgeID	Yes
assertionByID	agent	agentID	No
assertionProtocolID	protocol	protocolID	No

assertionID

Title (Label)	Assertion ID
Namespace	dwc
Table:	ChronometricAgeAssertion
IRI	http://rs.tdwg.org/dwc/terms/measurementID
Description	An identifier for an Assertion.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': True}
Format	default

chronometricAgeID

Title (Label)	Chronometric Age ID
Namespace	chrono
Table:	ChronometricAgeAssertion
IRI	http://rs.tdwg.org/chrono/terms/chronometricAgeID
Description	An identifier for a chrono:ChronometricAge.
Comments	Recommended best practice is to use a globally unique identifier.
Examples	`https://www.canadianarchaeology.ca/samples/70673`
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

verbatimAssertionType

Title (Label)	Verbatim Assertion Type
Namespace	dwc
Table:	ChronometricAgeAssertion
IRI	http://rs.tdwg.org/dwc/terms/verbatimMeasurementType
Description	A string representing the type of Assertion as it appeared in the original record.
Comments	This term is meant to allow the capture of an unaltered original name for an Assertion type. This term is meant to be used in addition to dwc:assertionType, not instead of it.
Examples	`water_temp` `Fish biomass` `sampling net mesh size`
Type	string
Format	default

assertionType

Title (Label)	Assertion Type
Namespace	dwcdp
Table:	ChronometricAgeAssertion
Description	A category that best matches the nature of an Assertion.
Examples	`mass` `mean mass` `weight standard deviation` `minimum organism quantity` `Temperature of the water body` `salinity` `Mesh size of sample collector`
Type	string
Format	default

assertionTypeIRI

Title (Label)	Assertion Type IRI
Namespace	dwcdp
Table:	ChronometricAgeAssertion
Description	An IRI of a controlled vocabulary value for a type of Assertion.
Comments	Recommended best practice is to use an IRI for a term in a controlled vocabulary.
Examples	`http://vocab.nerc.ac.uk/collection/P01/current/TEMPPR01/` `http://vocab.nerc.ac.uk/collection/P01/current/SDBIOL05/` `http://vocab.nerc.ac.uk/collection/P01/current/MSHSIZE1/`
Type	string
Format	default

assertionTypeVocabulary

Title (Label)	Assertion Type Vocabulary
Namespace	dwcdp
Table:	ChronometricAgeAssertion
Description	A reference to the controlled vocabulary in which the definition of a value in assertionType is given.
Examples	http://vocab.nerc.ac.uk/collection/P01/current/
Type	string
Format	default

assertionMadeDate

Title (Label)	Assertion Made Date
Namespace	dwcdp
Table:	ChronometricAgeAssertion
Description	A date on which an Assertion was created.
Comments	Recommended best practice is to use a date that conforms to ISO 8601-1:2019.
Examples	`2024-07-29`
Type	string
Format	default

assertionEffectiveDate

Title (Label)	Assertion Effective Date
Namespace	dwcdp
Table:	ChronometricAgeAssertion
IRI	http://rs.tdwg.org/dwc/terms/measurementDeterminedDate
Description	A date on which a state or measurement of an Assertion was deemed to first be in effect.
Comments	Recommended best practice is to use a date that conforms to ISO 8601-1:2019.
Examples	`2024-07-29`
Type	string
Format	default

assertionValue

Title (Label)	Assertion Value
Namespace	dwcdp
Table:	ChronometricAgeAssertion
Description	An asserted value, if it is not numeric.
Examples	`UV-light`
Type	string
Format	default

assertionValueIRI

Title (Label)	Assertion Value IRI
Namespace	dwcdp
Table:	ChronometricAgeAssertion
Description	An IRI of the controlled vocabulary value for a value of an Assertion.
Comments	Recommended best practice is to use an IRI for a term in a controlled vocabulary.
Examples	`https://vocab.nerc.ac.uk/collection/S10/current/S103/`
Type	string
Format	default

assertionValueVocabulary

Title (Label)	Assertion Value Vocabulary
Namespace	dwcdp
Table:	ChronometricAgeAssertion
Description	A reference to a controlled vocabulary in which the definition of a value in assertionValue is given.
Examples	`https://vocab.nerc.ac.uk/collection/S10/current/`
Type	string
Format	default

assertionValueNumeric

Title (Label)	Assertion Value Numeric
Namespace	dwcdp
Table:	ChronometricAgeAssertion
Description	An asserted value, if it is numeric.
Examples	`0` `1` `14.5`
Type	number
Format	default

assertionUnit

Title (Label)	Assertion Unit
Namespace	dwcdp
Table:	ChronometricAgeAssertion
IRI	http://rs.tdwg.org/dwc/terms/measurementUnit
Description	Units associated with the value in assertionValueNumeric.
Comments	Recommended best practice is to use a controlled vocabulary such as the Ontology of Units of Measure http://www.wurvoc.org/vocabularies/om-1.8/ of SI units, derived units, or other non-SI units accepted for use within the SI. For units that are composed of multiple parts, use the patterns as given in "A Primer for Communicating Mathematics via Plain Text" (https://cse.sc.edu/~fenner/latex-ASCII.pdf) by Stephen Fenner (e.g., `g/cm^3` for grams per cubic centimeter). For other units, provide the value as a recognizable standard (e.g., '%') or written out in full and in the plural (e.g., `individuals`). It is fine to provide non-SI units in the original language of the dataset.
Examples	`m` `g` `l` `s` `°C` `mm` `km²` `%` `hh:mm:ss`
Type	string
Format	default

assertionUnitIRI

Title (Label)	Assertion Unit IRI
Namespace	dwcdp
Table:	ChronometricAgeAssertion
Description	An IRI of a controlled vocabulary value for the units of an assertionValueNumeric.
Comments	Recommended best practice is to use an IRI for a term in a controlled vocabulary.
Type	string
Format	default

assertionUnitVocabulary

Title (Label)	Assertion Unit Vocabulary
Namespace	dwcdp
Table:	ChronometricAgeAssertion
Description	A reference to a controlled vocabulary in which the definition of the value in assertionUnit is given.
Type	string
Format	default

assertionBy

Title (Label)	Assertion By
Namespace	dwc
Table:	ChronometricAgeAssertion
IRI	http://rs.tdwg.org/dwc/terms/measurementDeterminedBy
Description	A list (concatenated and separated) of names of Agents responsible for making an Assertion.
Comments	Recommended best practice is to separate the values in a list with space vertical bar space ( \| ).
Examples	`José E. Crespo` `Oliver P. Pearson \| Anita K. Pearson` `FMNH` `bdqtestrunner`
Type	string
Format	default

assertionByID

Title (Label)	Assertion By ID
Namespace	dwcdp
Table:	ChronometricAgeAssertion
Description	An identifier for an Agent responsible for making an Assertion.
Comments	Recommended best practice is to use a globally unique identifier.
Examples	`https://orcid.org/0000-0002-1825-0097` (for an individual) `https://orcid.org/0000-0002-1825-0097 \| https://orcid.org/0000-0002-1825-0098` (for a list of people)
Type	string
Format	default

assertionProtocols

Title (Label)	Assertion Protocols
Namespace	dwcdp
Table:	ChronometricAgeAssertion
IRI	http://rs.tdwg.org/dwc/terms/measurementMethod
Description	Names of, references to, or descriptions of Protocols used in making an Assertion.
Type	string
Format	default

assertionProtocolID

Title (Label)	Assertion Protocol ID
Namespace	dwcdp
Table:	ChronometricAgeAssertion
IRI	http://rs.tdwg.org/dwc/iri/measurementMethod
Description	An identifier for a Protocol used to make an Assertion.
Type	string
Format	default

assertionReferences

Title (Label)	Assertion References
Namespace	dwcdp
Table:	ChronometricAgeAssertion
Description	A list (concatenated and separated) of identifiers (publication, bibliographic reference, global unique identifier, URI) of literature associated with an Assertion.
Comments	Recommended best practice is to separate the values in a list with space vertical bar space (` \| `).
Examples	`http://www.sciencemag.org/cgi/content/abstract/322/5899/261` `Christopher J. Conroy, Jennifer L. Neuwald. 2008. Phylogeographic study of the California vole, Microtus californicus Journal of Mammalogy, 89(3):755-767.` `Steven R. Hoofer and Ronald A. Van Den Bussche. 2001. Phylogenetic Relationships of Plecotine Bats and Allies Based on Mitochondrial Ribosomal Sequences. Journal of Mammalogy 82(1):131-137. \| Walker, Faith M., Jeffrey T. Foster, Kevin P. Drees, Carol L. Chambers. 2014. Spotted bat (Euderma maculatum) microsatellite discovery using illumina sequencing. Conservation Genetics Resources.`
Type	string
Format	default

assertionRemarks

Title (Label)	Assertion Remarks
Namespace	dwcdp
Table:	ChronometricAgeAssertion
IRI	http://rs.tdwg.org/dwc/terms/measurementRemarks
Description	Comments or notes about an Assertion.
Type	string
Format	default

EventAssertion

Identifier: http://rs.tdwg.org/dwc/dwc-dp/event-assertion

Description: An Assertion made by an Agent about a dwc:Event.

Relationships to Other Tables

Field	Target Table	Target Field	Required
eventID	event	eventID	Yes
assertionByID	agent	agentID	No
assertionProtocolID	protocol	protocolID	No

assertionID

Title (Label)	Assertion ID
Namespace	dwc
Table:	EventAssertion
IRI	http://rs.tdwg.org/dwc/terms/measurementID
Description	An identifier for an Assertion.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': True}
Format	default

eventID

Title (Label)	Event ID
Namespace	dwc
Table:	EventAssertion
IRI	http://rs.tdwg.org/dwc/terms/eventID
Description	An identifier for a dwc:Event.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

verbatimAssertionType

Title (Label)	Verbatim Assertion Type
Namespace	dwc
Table:	EventAssertion
IRI	http://rs.tdwg.org/dwc/terms/verbatimMeasurementType
Description	A string representing the type of Assertion as it appeared in the original record.
Comments	This term is meant to allow the capture of an unaltered original name for an Assertion type. This term is meant to be used in addition to dwc:assertionType, not instead of it.
Examples	`water_temp` `Fish biomass` `sampling net mesh size`
Type	string
Format	default

assertionType

Title (Label)	Assertion Type
Namespace	dwcdp
Table:	EventAssertion
Description	A category that best matches the nature of an Assertion.
Examples	`mass` `mean mass` `weight standard deviation` `minimum organism quantity` `Temperature of the water body` `salinity` `Mesh size of sample collector`
Type	string
Format	default

assertionTypeIRI

Title (Label)	Assertion Type IRI
Namespace	dwcdp
Table:	EventAssertion
Description	An IRI of a controlled vocabulary value for a type of Assertion.
Comments	Recommended best practice is to use an IRI for a term in a controlled vocabulary.
Examples	`http://vocab.nerc.ac.uk/collection/P01/current/TEMPPR01/` `http://vocab.nerc.ac.uk/collection/P01/current/SDBIOL05/` `http://vocab.nerc.ac.uk/collection/P01/current/MSHSIZE1/`
Type	string
Format	default

assertionTypeVocabulary

Title (Label)	Assertion Type Vocabulary
Namespace	dwcdp
Table:	EventAssertion
Description	A reference to the controlled vocabulary in which the definition of a value in assertionType is given.
Examples	http://vocab.nerc.ac.uk/collection/P01/current/
Type	string
Format	default

assertionMadeDate

Title (Label)	Assertion Made Date
Namespace	dwcdp
Table:	EventAssertion
Description	A date on which an Assertion was created.
Comments	Recommended best practice is to use a date that conforms to ISO 8601-1:2019.
Examples	`2024-07-29`
Type	string
Format	default

assertionEffectiveDate

Title (Label)	Assertion Effective Date
Namespace	dwcdp
Table:	EventAssertion
IRI	http://rs.tdwg.org/dwc/terms/measurementDeterminedDate
Description	A date on which a state or measurement of an Assertion was deemed to first be in effect.
Comments	Recommended best practice is to use a date that conforms to ISO 8601-1:2019.
Examples	`2024-07-29`
Type	string
Format	default

assertionValue

Title (Label)	Assertion Value
Namespace	dwcdp
Table:	EventAssertion
Description	An asserted value, if it is not numeric.
Examples	`UV-light`
Type	string
Format	default

assertionValueIRI

Title (Label)	Assertion Value IRI
Namespace	dwcdp
Table:	EventAssertion
Description	An IRI of the controlled vocabulary value for a value of an Assertion.
Comments	Recommended best practice is to use an IRI for a term in a controlled vocabulary.
Examples	`https://vocab.nerc.ac.uk/collection/S10/current/S103/`
Type	string
Format	default

assertionValueVocabulary

Title (Label)	Assertion Value Vocabulary
Namespace	dwcdp
Table:	EventAssertion
Description	A reference to a controlled vocabulary in which the definition of a value in assertionValue is given.
Examples	`https://vocab.nerc.ac.uk/collection/S10/current/`
Type	string
Format	default

assertionValueNumeric

Title (Label)	Assertion Value Numeric
Namespace	dwcdp
Table:	EventAssertion
Description	An asserted value, if it is numeric.
Examples	`0` `1` `14.5`
Type	number
Format	default

assertionUnit

Title (Label)	Assertion Unit
Namespace	dwcdp
Table:	EventAssertion
IRI	http://rs.tdwg.org/dwc/terms/measurementUnit
Description	Units associated with the value in assertionValueNumeric.
Comments	Recommended best practice is to use a controlled vocabulary such as the Ontology of Units of Measure http://www.wurvoc.org/vocabularies/om-1.8/ of SI units, derived units, or other non-SI units accepted for use within the SI. For units that are composed of multiple parts, use the patterns as given in "A Primer for Communicating Mathematics via Plain Text" (https://cse.sc.edu/~fenner/latex-ASCII.pdf) by Stephen Fenner (e.g., `g/cm^3` for grams per cubic centimeter). For other units, provide the value as a recognizable standard (e.g., '%') or written out in full and in the plural (e.g., `individuals`). It is fine to provide non-SI units in the original language of the dataset.
Examples	`m` `g` `l` `s` `°C` `mm` `km²` `%` `hh:mm:ss`
Type	string
Format	default

assertionUnitIRI

Title (Label)	Assertion Unit IRI
Namespace	dwcdp
Table:	EventAssertion
Description	An IRI of a controlled vocabulary value for the units of an assertionValueNumeric.
Comments	Recommended best practice is to use an IRI for a term in a controlled vocabulary.
Type	string
Format	default

assertionUnitVocabulary

Title (Label)	Assertion Unit Vocabulary
Namespace	dwcdp
Table:	EventAssertion
Description	A reference to a controlled vocabulary in which the definition of the value in assertionUnit is given.
Type	string
Format	default

assertionBy

Title (Label)	Assertion By
Namespace	dwc
Table:	EventAssertion
IRI	http://rs.tdwg.org/dwc/terms/measurementDeterminedBy
Description	A list (concatenated and separated) of names of Agents responsible for making an Assertion.
Comments	Recommended best practice is to separate the values in a list with space vertical bar space ( \| ).
Examples	`José E. Crespo` `Oliver P. Pearson \| Anita K. Pearson` `FMNH` `bdqtestrunner`
Type	string
Format	default

assertionByID

Title (Label)	Assertion By ID
Namespace	dwcdp
Table:	EventAssertion
Description	An identifier for an Agent responsible for making an Assertion.
Comments	Recommended best practice is to use a globally unique identifier.
Examples	`https://orcid.org/0000-0002-1825-0097` (for an individual) `https://orcid.org/0000-0002-1825-0097 \| https://orcid.org/0000-0002-1825-0098` (for a list of people)
Type	string
Format	default

assertionProtocols

Title (Label)	Assertion Protocols
Namespace	dwcdp
Table:	EventAssertion
IRI	http://rs.tdwg.org/dwc/terms/measurementMethod
Description	Names of, references to, or descriptions of Protocols used in making an Assertion.
Type	string
Format	default

assertionProtocolID

Title (Label)	Assertion Protocol ID
Namespace	dwcdp
Table:	EventAssertion
IRI	http://rs.tdwg.org/dwc/iri/measurementMethod
Description	An identifier for a Protocol used to make an Assertion.
Type	string
Format	default

assertionReferences

Title (Label)	Assertion References
Namespace	dwcdp
Table:	EventAssertion
Description	A list (concatenated and separated) of identifiers (publication, bibliographic reference, global unique identifier, URI) of literature associated with an Assertion.
Comments	Recommended best practice is to separate the values in a list with space vertical bar space (` \| `).
Examples	`http://www.sciencemag.org/cgi/content/abstract/322/5899/261` `Christopher J. Conroy, Jennifer L. Neuwald. 2008. Phylogeographic study of the California vole, Microtus californicus Journal of Mammalogy, 89(3):755-767.` `Steven R. Hoofer and Ronald A. Van Den Bussche. 2001. Phylogenetic Relationships of Plecotine Bats and Allies Based on Mitochondrial Ribosomal Sequences. Journal of Mammalogy 82(1):131-137. \| Walker, Faith M., Jeffrey T. Foster, Kevin P. Drees, Carol L. Chambers. 2014. Spotted bat (Euderma maculatum) microsatellite discovery using illumina sequencing. Conservation Genetics Resources.`
Type	string
Format	default

assertionRemarks

Title (Label)	Assertion Remarks
Namespace	dwcdp
Table:	EventAssertion
IRI	http://rs.tdwg.org/dwc/terms/measurementRemarks
Description	Comments or notes about an Assertion.
Type	string
Format	default

MaterialAssertion

Identifier: http://rs.tdwg.org/dwc/dwc-dp/material-assertion

Description: An Assertion made by an Agent about a dwc:MaterialEntity.

Relationships to Other Tables

Field	Target Table	Target Field	Required
materialEntityID	material	materialEntityID	Yes
assertionByID	agent	agentID	No
assertionProtocolID	protocol	protocolID	No

assertionID

Title (Label)	Assertion ID
Namespace	dwc
Table:	MaterialAssertion
IRI	http://rs.tdwg.org/dwc/terms/measurementID
Description	An identifier for an Assertion.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': True}
Format	default

materialEntityID

Title (Label)	Material Entity ID
Namespace	dwc
Table:	MaterialAssertion
IRI	http://rs.tdwg.org/dwc/terms/materialEntityID
Description	An identifier for a dwc:MaterialEntity.
Comments	Values of dwc:materialEntityID are intended to uniquely and persistently identify a particular dwc:MaterialEntity within some context. Examples of context include a particular sample collection, an organization, or the worldwide scale. Recommended best practice is to use a persistent, globally unique identifier. The identifier is bound to a physical object (a dwc:MaterialEntity) as opposed to a particular digital record (representation) of that physical object.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

verbatimAssertionType

Title (Label)	Verbatim Assertion Type
Namespace	dwc
Table:	MaterialAssertion
IRI	http://rs.tdwg.org/dwc/terms/verbatimMeasurementType
Description	A string representing the type of Assertion as it appeared in the original record.
Comments	This term is meant to allow the capture of an unaltered original name for an Assertion type. This term is meant to be used in addition to dwc:assertionType, not instead of it.
Examples	`water_temp` `Fish biomass` `sampling net mesh size`
Type	string
Format	default

assertionType

Title (Label)	Assertion Type
Namespace	dwcdp
Table:	MaterialAssertion
Description	A category that best matches the nature of an Assertion.
Examples	`mass` `mean mass` `weight standard deviation` `minimum organism quantity` `Temperature of the water body` `salinity` `Mesh size of sample collector`
Type	string
Format	default

assertionTypeIRI

Title (Label)	Assertion Type IRI
Namespace	dwcdp
Table:	MaterialAssertion
Description	An IRI of a controlled vocabulary value for a type of Assertion.
Comments	Recommended best practice is to use an IRI for a term in a controlled vocabulary.
Examples	`http://vocab.nerc.ac.uk/collection/P01/current/TEMPPR01/` `http://vocab.nerc.ac.uk/collection/P01/current/SDBIOL05/` `http://vocab.nerc.ac.uk/collection/P01/current/MSHSIZE1/`
Type	string
Format	default

assertionTypeVocabulary

Title (Label)	Assertion Type Vocabulary
Namespace	dwcdp
Table:	MaterialAssertion
Description	A reference to the controlled vocabulary in which the definition of a value in assertionType is given.
Examples	http://vocab.nerc.ac.uk/collection/P01/current/
Type	string
Format	default

assertionMadeDate

Title (Label)	Assertion Made Date
Namespace	dwcdp
Table:	MaterialAssertion
Description	A date on which an Assertion was created.
Comments	Recommended best practice is to use a date that conforms to ISO 8601-1:2019.
Examples	`2024-07-29`
Type	string
Format	default

assertionEffectiveDate

Title (Label)	Assertion Effective Date
Namespace	dwcdp
Table:	MaterialAssertion
IRI	http://rs.tdwg.org/dwc/terms/measurementDeterminedDate
Description	A date on which a state or measurement of an Assertion was deemed to first be in effect.
Comments	Recommended best practice is to use a date that conforms to ISO 8601-1:2019.
Examples	`2024-07-29`
Type	string
Format	default

assertionValue

Title (Label)	Assertion Value
Namespace	dwcdp
Table:	MaterialAssertion
Description	An asserted value, if it is not numeric.
Examples	`UV-light`
Type	string
Format	default

assertionValueIRI

Title (Label)	Assertion Value IRI
Namespace	dwcdp
Table:	MaterialAssertion
Description	An IRI of the controlled vocabulary value for a value of an Assertion.
Comments	Recommended best practice is to use an IRI for a term in a controlled vocabulary.
Examples	`https://vocab.nerc.ac.uk/collection/S10/current/S103/`
Type	string
Format	default

assertionValueVocabulary

Title (Label)	Assertion Value Vocabulary
Namespace	dwcdp
Table:	MaterialAssertion
Description	A reference to a controlled vocabulary in which the definition of a value in assertionValue is given.
Examples	`https://vocab.nerc.ac.uk/collection/S10/current/`
Type	string
Format	default

assertionValueNumeric

Title (Label)	Assertion Value Numeric
Namespace	dwcdp
Table:	MaterialAssertion
Description	An asserted value, if it is numeric.
Examples	`0` `1` `14.5`
Type	number
Format	default

assertionUnit

Title (Label)	Assertion Unit
Namespace	dwcdp
Table:	MaterialAssertion
IRI	http://rs.tdwg.org/dwc/terms/measurementUnit
Description	Units associated with the value in assertionValueNumeric.
Comments	Recommended best practice is to use a controlled vocabulary such as the Ontology of Units of Measure http://www.wurvoc.org/vocabularies/om-1.8/ of SI units, derived units, or other non-SI units accepted for use within the SI. For units that are composed of multiple parts, use the patterns as given in "A Primer for Communicating Mathematics via Plain Text" (https://cse.sc.edu/~fenner/latex-ASCII.pdf) by Stephen Fenner (e.g., `g/cm^3` for grams per cubic centimeter). For other units, provide the value as a recognizable standard (e.g., '%') or written out in full and in the plural (e.g., `individuals`). It is fine to provide non-SI units in the original language of the dataset.
Examples	`m` `g` `l` `s` `°C` `mm` `km²` `%` `hh:mm:ss`
Type	string
Format	default

assertionUnitIRI

Title (Label)	Assertion Unit IRI
Namespace	dwcdp
Table:	MaterialAssertion
Description	An IRI of a controlled vocabulary value for the units of an assertionValueNumeric.
Comments	Recommended best practice is to use an IRI for a term in a controlled vocabulary.
Type	string
Format	default

assertionUnitVocabulary

Title (Label)	Assertion Unit Vocabulary
Namespace	dwcdp
Table:	MaterialAssertion
Description	A reference to a controlled vocabulary in which the definition of the value in assertionUnit is given.
Type	string
Format	default

assertionBy

Title (Label)	Assertion By
Namespace	dwc
Table:	MaterialAssertion
IRI	http://rs.tdwg.org/dwc/terms/measurementDeterminedBy
Description	A list (concatenated and separated) of names of Agents responsible for making an Assertion.
Comments	Recommended best practice is to separate the values in a list with space vertical bar space ( \| ).
Examples	`José E. Crespo` `Oliver P. Pearson \| Anita K. Pearson` `FMNH` `bdqtestrunner`
Type	string
Format	default

assertionByID

Title (Label)	Assertion By ID
Namespace	dwcdp
Table:	MaterialAssertion
Description	An identifier for an Agent responsible for making an Assertion.
Comments	Recommended best practice is to use a globally unique identifier.
Examples	`https://orcid.org/0000-0002-1825-0097` (for an individual) `https://orcid.org/0000-0002-1825-0097 \| https://orcid.org/0000-0002-1825-0098` (for a list of people)
Type	string
Format	default

assertionProtocols

Title (Label)	Assertion Protocols
Namespace	dwcdp
Table:	MaterialAssertion
IRI	http://rs.tdwg.org/dwc/terms/measurementMethod
Description	Names of, references to, or descriptions of Protocols used in making an Assertion.
Type	string
Format	default

assertionProtocolID

Title (Label)	Assertion Protocol ID
Namespace	dwcdp
Table:	MaterialAssertion
IRI	http://rs.tdwg.org/dwc/iri/measurementMethod
Description	An identifier for a Protocol used to make an Assertion.
Type	string
Format	default

assertionReferences

Title (Label)	Assertion References
Namespace	dwcdp
Table:	MaterialAssertion
Description	A list (concatenated and separated) of identifiers (publication, bibliographic reference, global unique identifier, URI) of literature associated with an Assertion.
Comments	Recommended best practice is to separate the values in a list with space vertical bar space (` \| `).
Examples	`http://www.sciencemag.org/cgi/content/abstract/322/5899/261` `Christopher J. Conroy, Jennifer L. Neuwald. 2008. Phylogeographic study of the California vole, Microtus californicus Journal of Mammalogy, 89(3):755-767.` `Steven R. Hoofer and Ronald A. Van Den Bussche. 2001. Phylogenetic Relationships of Plecotine Bats and Allies Based on Mitochondrial Ribosomal Sequences. Journal of Mammalogy 82(1):131-137. \| Walker, Faith M., Jeffrey T. Foster, Kevin P. Drees, Carol L. Chambers. 2014. Spotted bat (Euderma maculatum) microsatellite discovery using illumina sequencing. Conservation Genetics Resources.`
Type	string
Format	default

assertionRemarks

Title (Label)	Assertion Remarks
Namespace	dwcdp
Table:	MaterialAssertion
IRI	http://rs.tdwg.org/dwc/terms/measurementRemarks
Description	Comments or notes about an Assertion.
Type	string
Format	default

MediaAssertion

Identifier: http://rs.tdwg.org/dwc/dwc-dp/media-assertion

Description: An Assertion made by an Agent about a Media entity.

Relationships to Other Tables

Field	Target Table	Target Field	Required
mediaID	media	mediaID	Yes
assertionByID	agent	agentID	No
assertionProtocolID	protocol	protocolID	No

assertionID

Title (Label)	Assertion ID
Namespace	dwc
Table:	MediaAssertion
IRI	http://rs.tdwg.org/dwc/terms/measurementID
Description	An identifier for an Assertion.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': True}
Format	default

mediaID

Title (Label)	Media ID
Namespace	dwcdp
Table:	MediaAssertion
Description	An identifier for a Media instance.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

verbatimAssertionType

Title (Label)	Verbatim Assertion Type
Namespace	dwc
Table:	MediaAssertion
IRI	http://rs.tdwg.org/dwc/terms/verbatimMeasurementType
Description	A string representing the type of Assertion as it appeared in the original record.
Comments	This term is meant to allow the capture of an unaltered original name for an Assertion type. This term is meant to be used in addition to dwc:assertionType, not instead of it.
Examples	`water_temp` `Fish biomass` `sampling net mesh size`
Type	string
Format	default

assertionType

Title (Label)	Assertion Type
Namespace	dwcdp
Table:	MediaAssertion
Description	A category that best matches the nature of an Assertion.
Examples	`mass` `mean mass` `weight standard deviation` `minimum organism quantity` `Temperature of the water body` `salinity` `Mesh size of sample collector`
Type	string
Format	default

assertionTypeIRI

Title (Label)	Assertion Type IRI
Namespace	dwcdp
Table:	MediaAssertion
Description	An IRI of a controlled vocabulary value for a type of Assertion.
Comments	Recommended best practice is to use an IRI for a term in a controlled vocabulary.
Examples	`http://vocab.nerc.ac.uk/collection/P01/current/TEMPPR01/` `http://vocab.nerc.ac.uk/collection/P01/current/SDBIOL05/` `http://vocab.nerc.ac.uk/collection/P01/current/MSHSIZE1/`
Type	string
Format	default

assertionTypeVocabulary

Title (Label)	Assertion Type Vocabulary
Namespace	dwcdp
Table:	MediaAssertion
Description	A reference to the controlled vocabulary in which the definition of a value in assertionType is given.
Examples	http://vocab.nerc.ac.uk/collection/P01/current/
Type	string
Format	default

assertionMadeDate

Title (Label)	Assertion Made Date
Namespace	dwcdp
Table:	MediaAssertion
Description	A date on which an Assertion was created.
Comments	Recommended best practice is to use a date that conforms to ISO 8601-1:2019.
Examples	`2024-07-29`
Type	string
Format	default

assertionEffectiveDate

Title (Label)	Assertion Effective Date
Namespace	dwcdp
Table:	MediaAssertion
IRI	http://rs.tdwg.org/dwc/terms/measurementDeterminedDate
Description	A date on which a state or measurement of an Assertion was deemed to first be in effect.
Comments	Recommended best practice is to use a date that conforms to ISO 8601-1:2019.
Examples	`2024-07-29`
Type	string
Format	default

assertionValue

Title (Label)	Assertion Value
Namespace	dwcdp
Table:	MediaAssertion
Description	An asserted value, if it is not numeric.
Examples	`UV-light`
Type	string
Format	default

assertionValueIRI

Title (Label)	Assertion Value IRI
Namespace	dwcdp
Table:	MediaAssertion
Description	An IRI of the controlled vocabulary value for a value of an Assertion.
Comments	Recommended best practice is to use an IRI for a term in a controlled vocabulary.
Examples	`https://vocab.nerc.ac.uk/collection/S10/current/S103/`
Type	string
Format	default

assertionValueVocabulary

Title (Label)	Assertion Value Vocabulary
Namespace	dwcdp
Table:	MediaAssertion
Description	A reference to a controlled vocabulary in which the definition of a value in assertionValue is given.
Examples	`https://vocab.nerc.ac.uk/collection/S10/current/`
Type	string
Format	default

assertionValueNumeric

Title (Label)	Assertion Value Numeric
Namespace	dwcdp
Table:	MediaAssertion
Description	An asserted value, if it is numeric.
Examples	`0` `1` `14.5`
Type	number
Format	default

assertionUnit

Title (Label)	Assertion Unit
Namespace	dwcdp
Table:	MediaAssertion
IRI	http://rs.tdwg.org/dwc/terms/measurementUnit
Description	Units associated with the value in assertionValueNumeric.
Comments	Recommended best practice is to use a controlled vocabulary such as the Ontology of Units of Measure http://www.wurvoc.org/vocabularies/om-1.8/ of SI units, derived units, or other non-SI units accepted for use within the SI. For units that are composed of multiple parts, use the patterns as given in "A Primer for Communicating Mathematics via Plain Text" (https://cse.sc.edu/~fenner/latex-ASCII.pdf) by Stephen Fenner (e.g., `g/cm^3` for grams per cubic centimeter). For other units, provide the value as a recognizable standard (e.g., '%') or written out in full and in the plural (e.g., `individuals`). It is fine to provide non-SI units in the original language of the dataset.
Examples	`m` `g` `l` `s` `°C` `mm` `km²` `%` `hh:mm:ss`
Type	string
Format	default

assertionUnitIRI

Title (Label)	Assertion Unit IRI
Namespace	dwcdp
Table:	MediaAssertion
Description	An IRI of a controlled vocabulary value for the units of an assertionValueNumeric.
Comments	Recommended best practice is to use an IRI for a term in a controlled vocabulary.
Type	string
Format	default

assertionUnitVocabulary

Title (Label)	Assertion Unit Vocabulary
Namespace	dwcdp
Table:	MediaAssertion
Description	A reference to a controlled vocabulary in which the definition of the value in assertionUnit is given.
Type	string
Format	default

assertionBy

Title (Label)	Assertion By
Namespace	dwc
Table:	MediaAssertion
IRI	http://rs.tdwg.org/dwc/terms/measurementDeterminedBy
Description	A list (concatenated and separated) of names of Agents responsible for making an Assertion.
Comments	Recommended best practice is to separate the values in a list with space vertical bar space ( \| ).
Examples	`José E. Crespo` `Oliver P. Pearson \| Anita K. Pearson` `FMNH` `bdqtestrunner`
Type	string
Format	default

assertionByID

Title (Label)	Assertion By ID
Namespace	dwcdp
Table:	MediaAssertion
Description	An identifier for an Agent responsible for making an Assertion.
Comments	Recommended best practice is to use a globally unique identifier.
Examples	`https://orcid.org/0000-0002-1825-0097` (for an individual) `https://orcid.org/0000-0002-1825-0097 \| https://orcid.org/0000-0002-1825-0098` (for a list of people)
Type	string
Format	default

assertionProtocols

Title (Label)	Assertion Protocols
Namespace	dwcdp
Table:	MediaAssertion
IRI	http://rs.tdwg.org/dwc/terms/measurementMethod
Description	Names of, references to, or descriptions of Protocols used in making an Assertion.
Type	string
Format	default

assertionProtocolID

Title (Label)	Assertion Protocol ID
Namespace	dwcdp
Table:	MediaAssertion
IRI	http://rs.tdwg.org/dwc/iri/measurementMethod
Description	An identifier for a Protocol used to make an Assertion.
Type	string
Format	default

assertionReferences

Title (Label)	Assertion References
Namespace	dwcdp
Table:	MediaAssertion
Description	A list (concatenated and separated) of identifiers (publication, bibliographic reference, global unique identifier, URI) of literature associated with an Assertion.
Comments	Recommended best practice is to separate the values in a list with space vertical bar space (` \| `).
Examples	`http://www.sciencemag.org/cgi/content/abstract/322/5899/261` `Christopher J. Conroy, Jennifer L. Neuwald. 2008. Phylogeographic study of the California vole, Microtus californicus Journal of Mammalogy, 89(3):755-767.` `Steven R. Hoofer and Ronald A. Van Den Bussche. 2001. Phylogenetic Relationships of Plecotine Bats and Allies Based on Mitochondrial Ribosomal Sequences. Journal of Mammalogy 82(1):131-137. \| Walker, Faith M., Jeffrey T. Foster, Kevin P. Drees, Carol L. Chambers. 2014. Spotted bat (Euderma maculatum) microsatellite discovery using illumina sequencing. Conservation Genetics Resources.`
Type	string
Format	default

assertionRemarks

Title (Label)	Assertion Remarks
Namespace	dwcdp
Table:	MediaAssertion
IRI	http://rs.tdwg.org/dwc/terms/measurementRemarks
Description	Comments or notes about an Assertion.
Type	string
Format	default

MolecularProtocolAssertion

Identifier: http://rs.tdwg.org/dwc/dwc-dp/molecular-protocol-assertion

Description: An Assertion made by an Agent about a MolecularProtocol.

Relationships to Other Tables

Field	Target Table	Target Field	Required
molecularProtocolID	molecular-protocol	molecularProtocolID	Yes
assertionByID	agent	agentID	No
assertionProtocolID	protocol	protocolID	No

assertionID

Title (Label)	Assertion ID
Namespace	dwc
Table:	MolecularProtocolAssertion
IRI	http://rs.tdwg.org/dwc/terms/measurementID
Description	An identifier for an Assertion.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': True}
Format	default

molecularProtocolID

Title (Label)	Molecular Protocol ID
Namespace	dwcdp
Table:	MolecularProtocolAssertion
Description	An identifier for a MolecularProtocol.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

verbatimAssertionType

Title (Label)	Verbatim Assertion Type
Namespace	dwc
Table:	MolecularProtocolAssertion
IRI	http://rs.tdwg.org/dwc/terms/verbatimMeasurementType
Description	A string representing the type of Assertion as it appeared in the original record.
Comments	This term is meant to allow the capture of an unaltered original name for an Assertion type. This term is meant to be used in addition to dwc:assertionType, not instead of it.
Examples	`water_temp` `Fish biomass` `sampling net mesh size`
Type	string
Format	default

assertionType

Title (Label)	Assertion Type
Namespace	dwcdp
Table:	MolecularProtocolAssertion
Description	A category that best matches the nature of an Assertion.
Examples	`mass` `mean mass` `weight standard deviation` `minimum organism quantity` `Temperature of the water body` `salinity` `Mesh size of sample collector`
Type	string
Format	default

assertionTypeIRI

Title (Label)	Assertion Type IRI
Namespace	dwcdp
Table:	MolecularProtocolAssertion
Description	An IRI of a controlled vocabulary value for a type of Assertion.
Comments	Recommended best practice is to use an IRI for a term in a controlled vocabulary.
Examples	`http://vocab.nerc.ac.uk/collection/P01/current/TEMPPR01/` `http://vocab.nerc.ac.uk/collection/P01/current/SDBIOL05/` `http://vocab.nerc.ac.uk/collection/P01/current/MSHSIZE1/`
Type	string
Format	default

assertionTypeVocabulary

Title (Label)	Assertion Type Vocabulary
Namespace	dwcdp
Table:	MolecularProtocolAssertion
Description	A reference to the controlled vocabulary in which the definition of a value in assertionType is given.
Examples	http://vocab.nerc.ac.uk/collection/P01/current/
Type	string
Format	default

assertionMadeDate

Title (Label)	Assertion Made Date
Namespace	dwcdp
Table:	MolecularProtocolAssertion
Description	A date on which an Assertion was created.
Comments	Recommended best practice is to use a date that conforms to ISO 8601-1:2019.
Examples	`2024-07-29`
Type	string
Format	default

assertionEffectiveDate

Title (Label)	Assertion Effective Date
Namespace	dwcdp
Table:	MolecularProtocolAssertion
IRI	http://rs.tdwg.org/dwc/terms/measurementDeterminedDate
Description	A date on which a state or measurement of an Assertion was deemed to first be in effect.
Comments	Recommended best practice is to use a date that conforms to ISO 8601-1:2019.
Examples	`2024-07-29`
Type	string
Format	default

assertionValue

Title (Label)	Assertion Value
Namespace	dwcdp
Table:	MolecularProtocolAssertion
Description	An asserted value, if it is not numeric.
Examples	`UV-light`
Type	string
Format	default

assertionValueIRI

Title (Label)	Assertion Value IRI
Namespace	dwcdp
Table:	MolecularProtocolAssertion
Description	An IRI of the controlled vocabulary value for a value of an Assertion.
Comments	Recommended best practice is to use an IRI for a term in a controlled vocabulary.
Examples	`https://vocab.nerc.ac.uk/collection/S10/current/S103/`
Type	string
Format	default

assertionValueVocabulary

Title (Label)	Assertion Value Vocabulary
Namespace	dwcdp
Table:	MolecularProtocolAssertion
Description	A reference to a controlled vocabulary in which the definition of a value in assertionValue is given.
Examples	`https://vocab.nerc.ac.uk/collection/S10/current/`
Type	string
Format	default

assertionValueNumeric

Title (Label)	Assertion Value Numeric
Namespace	dwcdp
Table:	MolecularProtocolAssertion
Description	An asserted value, if it is numeric.
Examples	`0` `1` `14.5`
Type	number
Format	default

assertionUnit

Title (Label)	Assertion Unit
Namespace	dwcdp
Table:	MolecularProtocolAssertion
IRI	http://rs.tdwg.org/dwc/terms/measurementUnit
Description	Units associated with the value in assertionValueNumeric.
Comments	Recommended best practice is to use a controlled vocabulary such as the Ontology of Units of Measure http://www.wurvoc.org/vocabularies/om-1.8/ of SI units, derived units, or other non-SI units accepted for use within the SI. For units that are composed of multiple parts, use the patterns as given in "A Primer for Communicating Mathematics via Plain Text" (https://cse.sc.edu/~fenner/latex-ASCII.pdf) by Stephen Fenner (e.g., `g/cm^3` for grams per cubic centimeter). For other units, provide the value as a recognizable standard (e.g., '%') or written out in full and in the plural (e.g., `individuals`). It is fine to provide non-SI units in the original language of the dataset.
Examples	`m` `g` `l` `s` `°C` `mm` `km²` `%` `hh:mm:ss`
Type	string
Format	default

assertionUnitIRI

Title (Label)	Assertion Unit IRI
Namespace	dwcdp
Table:	MolecularProtocolAssertion
Description	An IRI of a controlled vocabulary value for the units of an assertionValueNumeric.
Comments	Recommended best practice is to use an IRI for a term in a controlled vocabulary.
Type	string
Format	default

assertionUnitVocabulary

Title (Label)	Assertion Unit Vocabulary
Namespace	dwcdp
Table:	MolecularProtocolAssertion
Description	A reference to a controlled vocabulary in which the definition of the value in assertionUnit is given.
Type	string
Format	default

assertionBy

Title (Label)	Assertion By
Namespace	dwc
Table:	MolecularProtocolAssertion
IRI	http://rs.tdwg.org/dwc/terms/measurementDeterminedBy
Description	A list (concatenated and separated) of names of Agents responsible for making an Assertion.
Comments	Recommended best practice is to separate the values in a list with space vertical bar space ( \| ).
Examples	`José E. Crespo` `Oliver P. Pearson \| Anita K. Pearson` `FMNH` `bdqtestrunner`
Type	string
Format	default

assertionByID

Title (Label)	Assertion By ID
Namespace	dwcdp
Table:	MolecularProtocolAssertion
Description	An identifier for an Agent responsible for making an Assertion.
Comments	Recommended best practice is to use a globally unique identifier.
Examples	`https://orcid.org/0000-0002-1825-0097` (for an individual) `https://orcid.org/0000-0002-1825-0097 \| https://orcid.org/0000-0002-1825-0098` (for a list of people)
Type	string
Format	default

assertionProtocols

Title (Label)	Assertion Protocols
Namespace	dwcdp
Table:	MolecularProtocolAssertion
IRI	http://rs.tdwg.org/dwc/terms/measurementMethod
Description	Names of, references to, or descriptions of Protocols used in making an Assertion.
Type	string
Format	default

assertionProtocolID

Title (Label)	Assertion Protocol ID
Namespace	dwcdp
Table:	MolecularProtocolAssertion
IRI	http://rs.tdwg.org/dwc/iri/measurementMethod
Description	An identifier for a Protocol used to make an Assertion.
Type	string
Format	default

assertionReferences

Title (Label)	Assertion References
Namespace	dwcdp
Table:	MolecularProtocolAssertion
Description	A list (concatenated and separated) of identifiers (publication, bibliographic reference, global unique identifier, URI) of literature associated with an Assertion.
Comments	Recommended best practice is to separate the values in a list with space vertical bar space (` \| `).
Examples	`http://www.sciencemag.org/cgi/content/abstract/322/5899/261` `Christopher J. Conroy, Jennifer L. Neuwald. 2008. Phylogeographic study of the California vole, Microtus californicus Journal of Mammalogy, 89(3):755-767.` `Steven R. Hoofer and Ronald A. Van Den Bussche. 2001. Phylogenetic Relationships of Plecotine Bats and Allies Based on Mitochondrial Ribosomal Sequences. Journal of Mammalogy 82(1):131-137. \| Walker, Faith M., Jeffrey T. Foster, Kevin P. Drees, Carol L. Chambers. 2014. Spotted bat (Euderma maculatum) microsatellite discovery using illumina sequencing. Conservation Genetics Resources.`
Type	string
Format	default

assertionRemarks

Title (Label)	Assertion Remarks
Namespace	dwcdp
Table:	MolecularProtocolAssertion
IRI	http://rs.tdwg.org/dwc/terms/measurementRemarks
Description	Comments or notes about an Assertion.
Type	string
Format	default

NucleotideAnalysisAssertion

Identifier: http://rs.tdwg.org/dwc/dwc-dp/nucleotide-analysis-assertion

Description: An Assertion made by an Agent about a NucleotideAnalysis.

Relationships to Other Tables

Field	Target Table	Target Field	Required
nucleotideAnalysisID	nucleotide-analysis	nucleotideAnalysisID	Yes
assertionByID	agent	agentID	No
assertionProtocolID	protocol	protocolID	No

assertionID

Title (Label)	Assertion ID
Namespace	dwc
Table:	NucleotideAnalysisAssertion
IRI	http://rs.tdwg.org/dwc/terms/measurementID
Description	An identifier for an Assertion.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': True}
Format	default

nucleotideAnalysisID

Title (Label)	Nucleotide Analysis ID
Namespace	dwcdp
Table:	NucleotideAnalysisAssertion
Description	An identifier for a NucleotideAnalysis.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

verbatimAssertionType

Title (Label)	Verbatim Assertion Type
Namespace	dwc
Table:	NucleotideAnalysisAssertion
IRI	http://rs.tdwg.org/dwc/terms/verbatimMeasurementType
Description	A string representing the type of Assertion as it appeared in the original record.
Comments	This term is meant to allow the capture of an unaltered original name for an Assertion type. This term is meant to be used in addition to dwc:assertionType, not instead of it.
Examples	`water_temp` `Fish biomass` `sampling net mesh size`
Type	string
Format	default

assertionType

Title (Label)	Assertion Type
Namespace	dwcdp
Table:	NucleotideAnalysisAssertion
Description	A category that best matches the nature of an Assertion.
Examples	`mass` `mean mass` `weight standard deviation` `minimum organism quantity` `Temperature of the water body` `salinity` `Mesh size of sample collector`
Type	string
Format	default

assertionTypeIRI

Title (Label)	Assertion Type IRI
Namespace	dwcdp
Table:	NucleotideAnalysisAssertion
Description	An IRI of a controlled vocabulary value for a type of Assertion.
Comments	Recommended best practice is to use an IRI for a term in a controlled vocabulary.
Examples	`http://vocab.nerc.ac.uk/collection/P01/current/TEMPPR01/` `http://vocab.nerc.ac.uk/collection/P01/current/SDBIOL05/` `http://vocab.nerc.ac.uk/collection/P01/current/MSHSIZE1/`
Type	string
Format	default

assertionTypeVocabulary

Title (Label)	Assertion Type Vocabulary
Namespace	dwcdp
Table:	NucleotideAnalysisAssertion
Description	A reference to the controlled vocabulary in which the definition of a value in assertionType is given.
Examples	http://vocab.nerc.ac.uk/collection/P01/current/
Type	string
Format	default

assertionMadeDate

Title (Label)	Assertion Made Date
Namespace	dwcdp
Table:	NucleotideAnalysisAssertion
Description	A date on which an Assertion was created.
Comments	Recommended best practice is to use a date that conforms to ISO 8601-1:2019.
Examples	`2024-07-29`
Type	string
Format	default

assertionEffectiveDate

Title (Label)	Assertion Effective Date
Namespace	dwcdp
Table:	NucleotideAnalysisAssertion
IRI	http://rs.tdwg.org/dwc/terms/measurementDeterminedDate
Description	A date on which a state or measurement of an Assertion was deemed to first be in effect.
Comments	Recommended best practice is to use a date that conforms to ISO 8601-1:2019.
Examples	`2024-07-29`
Type	string
Format	default

assertionValue

Title (Label)	Assertion Value
Namespace	dwcdp
Table:	NucleotideAnalysisAssertion
Description	An asserted value, if it is not numeric.
Examples	`UV-light`
Type	string
Format	default

assertionValueIRI

Title (Label)	Assertion Value IRI
Namespace	dwcdp
Table:	NucleotideAnalysisAssertion
Description	An IRI of the controlled vocabulary value for a value of an Assertion.
Comments	Recommended best practice is to use an IRI for a term in a controlled vocabulary.
Examples	`https://vocab.nerc.ac.uk/collection/S10/current/S103/`
Type	string
Format	default

assertionValueVocabulary

Title (Label)	Assertion Value Vocabulary
Namespace	dwcdp
Table:	NucleotideAnalysisAssertion
Description	A reference to a controlled vocabulary in which the definition of a value in assertionValue is given.
Examples	`https://vocab.nerc.ac.uk/collection/S10/current/`
Type	string
Format	default

assertionValueNumeric

Title (Label)	Assertion Value Numeric
Namespace	dwcdp
Table:	NucleotideAnalysisAssertion
Description	An asserted value, if it is numeric.
Examples	`0` `1` `14.5`
Type	number
Format	default

assertionUnit

Title (Label)	Assertion Unit
Namespace	dwcdp
Table:	NucleotideAnalysisAssertion
IRI	http://rs.tdwg.org/dwc/terms/measurementUnit
Description	Units associated with the value in assertionValueNumeric.
Comments	Recommended best practice is to use a controlled vocabulary such as the Ontology of Units of Measure http://www.wurvoc.org/vocabularies/om-1.8/ of SI units, derived units, or other non-SI units accepted for use within the SI. For units that are composed of multiple parts, use the patterns as given in "A Primer for Communicating Mathematics via Plain Text" (https://cse.sc.edu/~fenner/latex-ASCII.pdf) by Stephen Fenner (e.g., `g/cm^3` for grams per cubic centimeter). For other units, provide the value as a recognizable standard (e.g., '%') or written out in full and in the plural (e.g., `individuals`). It is fine to provide non-SI units in the original language of the dataset.
Examples	`m` `g` `l` `s` `°C` `mm` `km²` `%` `hh:mm:ss`
Type	string
Format	default

assertionUnitIRI

Title (Label)	Assertion Unit IRI
Namespace	dwcdp
Table:	NucleotideAnalysisAssertion
Description	An IRI of a controlled vocabulary value for the units of an assertionValueNumeric.
Comments	Recommended best practice is to use an IRI for a term in a controlled vocabulary.
Type	string
Format	default

assertionUnitVocabulary

Title (Label)	Assertion Unit Vocabulary
Namespace	dwcdp
Table:	NucleotideAnalysisAssertion
Description	A reference to a controlled vocabulary in which the definition of the value in assertionUnit is given.
Type	string
Format	default

assertionBy

Title (Label)	Assertion By
Namespace	dwc
Table:	NucleotideAnalysisAssertion
IRI	http://rs.tdwg.org/dwc/terms/measurementDeterminedBy
Description	A list (concatenated and separated) of names of Agents responsible for making an Assertion.
Comments	Recommended best practice is to separate the values in a list with space vertical bar space ( \| ).
Examples	`José E. Crespo` `Oliver P. Pearson \| Anita K. Pearson` `FMNH` `bdqtestrunner`
Type	string
Format	default

assertionByID

Title (Label)	Assertion By ID
Namespace	dwcdp
Table:	NucleotideAnalysisAssertion
Description	An identifier for an Agent responsible for making an Assertion.
Comments	Recommended best practice is to use a globally unique identifier.
Examples	`https://orcid.org/0000-0002-1825-0097` (for an individual) `https://orcid.org/0000-0002-1825-0097 \| https://orcid.org/0000-0002-1825-0098` (for a list of people)
Type	string
Format	default

assertionProtocols

Title (Label)	Assertion Protocols
Namespace	dwcdp
Table:	NucleotideAnalysisAssertion
IRI	http://rs.tdwg.org/dwc/terms/measurementMethod
Description	Names of, references to, or descriptions of Protocols used in making an Assertion.
Type	string
Format	default

assertionProtocolID

Title (Label)	Assertion Protocol ID
Namespace	dwcdp
Table:	NucleotideAnalysisAssertion
IRI	http://rs.tdwg.org/dwc/iri/measurementMethod
Description	An identifier for a Protocol used to make an Assertion.
Type	string
Format	default

assertionReferences

Title (Label)	Assertion References
Namespace	dwcdp
Table:	NucleotideAnalysisAssertion
Description	A list (concatenated and separated) of identifiers (publication, bibliographic reference, global unique identifier, URI) of literature associated with an Assertion.
Comments	Recommended best practice is to separate the values in a list with space vertical bar space (` \| `).
Examples	`http://www.sciencemag.org/cgi/content/abstract/322/5899/261` `Christopher J. Conroy, Jennifer L. Neuwald. 2008. Phylogeographic study of the California vole, Microtus californicus Journal of Mammalogy, 89(3):755-767.` `Steven R. Hoofer and Ronald A. Van Den Bussche. 2001. Phylogenetic Relationships of Plecotine Bats and Allies Based on Mitochondrial Ribosomal Sequences. Journal of Mammalogy 82(1):131-137. \| Walker, Faith M., Jeffrey T. Foster, Kevin P. Drees, Carol L. Chambers. 2014. Spotted bat (Euderma maculatum) microsatellite discovery using illumina sequencing. Conservation Genetics Resources.`
Type	string
Format	default

assertionRemarks

Title (Label)	Assertion Remarks
Namespace	dwcdp
Table:	NucleotideAnalysisAssertion
IRI	http://rs.tdwg.org/dwc/terms/measurementRemarks
Description	Comments or notes about an Assertion.
Type	string
Format	default

OccurrenceAssertion

Identifier: http://rs.tdwg.org/dwc/dwc-dp/occurrence-assertion

Description: An Assertion made by an Agent about a dwc:Occurrence.

Relationships to Other Tables

Field	Target Table	Target Field	Required
occurrenceID	occurrence	occurrenceID	Yes
assertionByID	agent	agentID	No
assertionProtocolID	protocol	protocolID	No

assertionID

Title (Label)	Assertion ID
Namespace	dwc
Table:	OccurrenceAssertion
IRI	http://rs.tdwg.org/dwc/terms/measurementID
Description	An identifier for an Assertion.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': True}
Format	default

occurrenceID

Title (Label)	Occurrence ID
Namespace	dwc
Table:	OccurrenceAssertion
IRI	http://rs.tdwg.org/dwc/terms/occurrenceID
Description	An identifier for a dwc:Occurrence.
Comments	Recommended best practice is to use a persistent, globally unique identifier. In the absence of a persistent global unique identifier, construct one from a combination of identifiers in the record that will most closely make a dwc:occurrenceID globally unique.
Examples	`http://arctos.database.museum/guid/MSB:Mamm:233627`
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

verbatimAssertionType

Title (Label)	Verbatim Assertion Type
Namespace	dwc
Table:	OccurrenceAssertion
IRI	http://rs.tdwg.org/dwc/terms/verbatimMeasurementType
Description	A string representing the type of Assertion as it appeared in the original record.
Comments	This term is meant to allow the capture of an unaltered original name for an Assertion type. This term is meant to be used in addition to dwc:assertionType, not instead of it.
Examples	`water_temp` `Fish biomass` `sampling net mesh size`
Type	string
Format	default

assertionType

Title (Label)	Assertion Type
Namespace	dwcdp
Table:	OccurrenceAssertion
Description	A category that best matches the nature of an Assertion.
Examples	`mass` `mean mass` `weight standard deviation` `minimum organism quantity` `Temperature of the water body` `salinity` `Mesh size of sample collector`
Type	string
Format	default

assertionTypeIRI

Title (Label)	Assertion Type IRI
Namespace	dwcdp
Table:	OccurrenceAssertion
Description	An IRI of a controlled vocabulary value for a type of Assertion.
Comments	Recommended best practice is to use an IRI for a term in a controlled vocabulary.
Examples	`http://vocab.nerc.ac.uk/collection/P01/current/TEMPPR01/` `http://vocab.nerc.ac.uk/collection/P01/current/SDBIOL05/` `http://vocab.nerc.ac.uk/collection/P01/current/MSHSIZE1/`
Type	string
Format	default

assertionTypeVocabulary

Title (Label)	Assertion Type Vocabulary
Namespace	dwcdp
Table:	OccurrenceAssertion
Description	A reference to the controlled vocabulary in which the definition of a value in assertionType is given.
Examples	http://vocab.nerc.ac.uk/collection/P01/current/
Type	string
Format	default

assertionMadeDate

Title (Label)	Assertion Made Date
Namespace	dwcdp
Table:	OccurrenceAssertion
Description	A date on which an Assertion was created.
Comments	Recommended best practice is to use a date that conforms to ISO 8601-1:2019.
Examples	`2024-07-29`
Type	string
Format	default

assertionEffectiveDate

Title (Label)	Assertion Effective Date
Namespace	dwcdp
Table:	OccurrenceAssertion
IRI	http://rs.tdwg.org/dwc/terms/measurementDeterminedDate
Description	A date on which a state or measurement of an Assertion was deemed to first be in effect.
Comments	Recommended best practice is to use a date that conforms to ISO 8601-1:2019.
Examples	`2024-07-29`
Type	string
Format	default

assertionValue

Title (Label)	Assertion Value
Namespace	dwcdp
Table:	OccurrenceAssertion
Description	An asserted value, if it is not numeric.
Examples	`UV-light`
Type	string
Format	default

assertionValueIRI

Title (Label)	Assertion Value IRI
Namespace	dwcdp
Table:	OccurrenceAssertion
Description	An IRI of the controlled vocabulary value for a value of an Assertion.
Comments	Recommended best practice is to use an IRI for a term in a controlled vocabulary.
Examples	`https://vocab.nerc.ac.uk/collection/S10/current/S103/`
Type	string
Format	default

assertionValueVocabulary

Title (Label)	Assertion Value Vocabulary
Namespace	dwcdp
Table:	OccurrenceAssertion
Description	A reference to a controlled vocabulary in which the definition of a value in assertionValue is given.
Examples	`https://vocab.nerc.ac.uk/collection/S10/current/`
Type	string
Format	default

assertionValueNumeric

Title (Label)	Assertion Value Numeric
Namespace	dwcdp
Table:	OccurrenceAssertion
Description	An asserted value, if it is numeric.
Examples	`0` `1` `14.5`
Type	number
Format	default

assertionUnit

Title (Label)	Assertion Unit
Namespace	dwcdp
Table:	OccurrenceAssertion
IRI	http://rs.tdwg.org/dwc/terms/measurementUnit
Description	Units associated with the value in assertionValueNumeric.
Comments	Recommended best practice is to use a controlled vocabulary such as the Ontology of Units of Measure http://www.wurvoc.org/vocabularies/om-1.8/ of SI units, derived units, or other non-SI units accepted for use within the SI. For units that are composed of multiple parts, use the patterns as given in "A Primer for Communicating Mathematics via Plain Text" (https://cse.sc.edu/~fenner/latex-ASCII.pdf) by Stephen Fenner (e.g., `g/cm^3` for grams per cubic centimeter). For other units, provide the value as a recognizable standard (e.g., '%') or written out in full and in the plural (e.g., `individuals`). It is fine to provide non-SI units in the original language of the dataset.
Examples	`m` `g` `l` `s` `°C` `mm` `km²` `%` `hh:mm:ss`
Type	string
Format	default

assertionUnitIRI

Title (Label)	Assertion Unit IRI
Namespace	dwcdp
Table:	OccurrenceAssertion
Description	An IRI of a controlled vocabulary value for the units of an assertionValueNumeric.
Comments	Recommended best practice is to use an IRI for a term in a controlled vocabulary.
Type	string
Format	default

assertionUnitVocabulary

Title (Label)	Assertion Unit Vocabulary
Namespace	dwcdp
Table:	OccurrenceAssertion
Description	A reference to a controlled vocabulary in which the definition of the value in assertionUnit is given.
Type	string
Format	default

assertionBy

Title (Label)	Assertion By
Namespace	dwc
Table:	OccurrenceAssertion
IRI	http://rs.tdwg.org/dwc/terms/measurementDeterminedBy
Description	A list (concatenated and separated) of names of Agents responsible for making an Assertion.
Comments	Recommended best practice is to separate the values in a list with space vertical bar space ( \| ).
Examples	`José E. Crespo` `Oliver P. Pearson \| Anita K. Pearson` `FMNH` `bdqtestrunner`
Type	string
Format	default

assertionByID

Title (Label)	Assertion By ID
Namespace	dwcdp
Table:	OccurrenceAssertion
Description	An identifier for an Agent responsible for making an Assertion.
Comments	Recommended best practice is to use a globally unique identifier.
Examples	`https://orcid.org/0000-0002-1825-0097` (for an individual) `https://orcid.org/0000-0002-1825-0097 \| https://orcid.org/0000-0002-1825-0098` (for a list of people)
Type	string
Format	default

assertionProtocols

Title (Label)	Assertion Protocols
Namespace	dwcdp
Table:	OccurrenceAssertion
IRI	http://rs.tdwg.org/dwc/terms/measurementMethod
Description	Names of, references to, or descriptions of Protocols used in making an Assertion.
Type	string
Format	default

assertionProtocolID

Title (Label)	Assertion Protocol ID
Namespace	dwcdp
Table:	OccurrenceAssertion
IRI	http://rs.tdwg.org/dwc/iri/measurementMethod
Description	An identifier for a Protocol used to make an Assertion.
Type	string
Format	default

assertionReferences

Title (Label)	Assertion References
Namespace	dwcdp
Table:	OccurrenceAssertion
Description	A list (concatenated and separated) of identifiers (publication, bibliographic reference, global unique identifier, URI) of literature associated with an Assertion.
Comments	Recommended best practice is to separate the values in a list with space vertical bar space (` \| `).
Examples	`http://www.sciencemag.org/cgi/content/abstract/322/5899/261` `Christopher J. Conroy, Jennifer L. Neuwald. 2008. Phylogeographic study of the California vole, Microtus californicus Journal of Mammalogy, 89(3):755-767.` `Steven R. Hoofer and Ronald A. Van Den Bussche. 2001. Phylogenetic Relationships of Plecotine Bats and Allies Based on Mitochondrial Ribosomal Sequences. Journal of Mammalogy 82(1):131-137. \| Walker, Faith M., Jeffrey T. Foster, Kevin P. Drees, Carol L. Chambers. 2014. Spotted bat (Euderma maculatum) microsatellite discovery using illumina sequencing. Conservation Genetics Resources.`
Type	string
Format	default

assertionRemarks

Title (Label)	Assertion Remarks
Namespace	dwcdp
Table:	OccurrenceAssertion
IRI	http://rs.tdwg.org/dwc/terms/measurementRemarks
Description	Comments or notes about an Assertion.
Type	string
Format	default

OrganismInteractionAssertion

Identifier: http://rs.tdwg.org/dwc/dwc-dp/organism-interaction-assertion

Description: An Assertion made by an Agent about an OrganismInteraction.

Relationships to Other Tables

Field	Target Table	Target Field	Required
organismInteractionID	organism-interaction	organismInteractionID	Yes
assertionByID	agent	agentID	No
assertionProtocolID	protocol	protocolID	No

assertionID

Title (Label)	Assertion ID
Namespace	dwc
Table:	OrganismInteractionAssertion
IRI	http://rs.tdwg.org/dwc/terms/measurementID
Description	An identifier for an Assertion.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': True}
Format	default

organismInteractionID

Title (Label)	Organism Interaction ID
Namespace	dwcdp
Table:	OrganismInteractionAssertion
Description	An identifier for an OrganismInteraction.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

verbatimAssertionType

Title (Label)	Verbatim Assertion Type
Namespace	dwc
Table:	OrganismInteractionAssertion
IRI	http://rs.tdwg.org/dwc/terms/verbatimMeasurementType
Description	A string representing the type of Assertion as it appeared in the original record.
Comments	This term is meant to allow the capture of an unaltered original name for an Assertion type. This term is meant to be used in addition to dwc:assertionType, not instead of it.
Examples	`water_temp` `Fish biomass` `sampling net mesh size`
Type	string
Format	default

assertionType

Title (Label)	Assertion Type
Namespace	dwcdp
Table:	OrganismInteractionAssertion
Description	A category that best matches the nature of an Assertion.
Examples	`mass` `mean mass` `weight standard deviation` `minimum organism quantity` `Temperature of the water body` `salinity` `Mesh size of sample collector`
Type	string
Format	default

assertionTypeIRI

Title (Label)	Assertion Type IRI
Namespace	dwcdp
Table:	OrganismInteractionAssertion
Description	An IRI of a controlled vocabulary value for a type of Assertion.
Comments	Recommended best practice is to use an IRI for a term in a controlled vocabulary.
Examples	`http://vocab.nerc.ac.uk/collection/P01/current/TEMPPR01/` `http://vocab.nerc.ac.uk/collection/P01/current/SDBIOL05/` `http://vocab.nerc.ac.uk/collection/P01/current/MSHSIZE1/`
Type	string
Format	default

assertionTypeVocabulary

Title (Label)	Assertion Type Vocabulary
Namespace	dwcdp
Table:	OrganismInteractionAssertion
Description	A reference to the controlled vocabulary in which the definition of a value in assertionType is given.
Examples	http://vocab.nerc.ac.uk/collection/P01/current/
Type	string
Format	default

assertionMadeDate

Title (Label)	Assertion Made Date
Namespace	dwcdp
Table:	OrganismInteractionAssertion
Description	A date on which an Assertion was created.
Comments	Recommended best practice is to use a date that conforms to ISO 8601-1:2019.
Examples	`2024-07-29`
Type	string
Format	default

assertionEffectiveDate

Title (Label)	Assertion Effective Date
Namespace	dwcdp
Table:	OrganismInteractionAssertion
IRI	http://rs.tdwg.org/dwc/terms/measurementDeterminedDate
Description	A date on which a state or measurement of an Assertion was deemed to first be in effect.
Comments	Recommended best practice is to use a date that conforms to ISO 8601-1:2019.
Examples	`2024-07-29`
Type	string
Format	default

assertionValue

Title (Label)	Assertion Value
Namespace	dwcdp
Table:	OrganismInteractionAssertion
Description	An asserted value, if it is not numeric.
Examples	`UV-light`
Type	string
Format	default

assertionValueIRI

Title (Label)	Assertion Value IRI
Namespace	dwcdp
Table:	OrganismInteractionAssertion
Description	An IRI of the controlled vocabulary value for a value of an Assertion.
Comments	Recommended best practice is to use an IRI for a term in a controlled vocabulary.
Examples	`https://vocab.nerc.ac.uk/collection/S10/current/S103/`
Type	string
Format	default

assertionValueVocabulary

Title (Label)	Assertion Value Vocabulary
Namespace	dwcdp
Table:	OrganismInteractionAssertion
Description	A reference to a controlled vocabulary in which the definition of a value in assertionValue is given.
Examples	`https://vocab.nerc.ac.uk/collection/S10/current/`
Type	string
Format	default

assertionValueNumeric

Title (Label)	Assertion Value Numeric
Namespace	dwcdp
Table:	OrganismInteractionAssertion
Description	An asserted value, if it is numeric.
Examples	`0` `1` `14.5`
Type	number
Format	default

assertionUnit

Title (Label)	Assertion Unit
Namespace	dwcdp
Table:	OrganismInteractionAssertion
IRI	http://rs.tdwg.org/dwc/terms/measurementUnit
Description	Units associated with the value in assertionValueNumeric.
Comments	Recommended best practice is to use a controlled vocabulary such as the Ontology of Units of Measure http://www.wurvoc.org/vocabularies/om-1.8/ of SI units, derived units, or other non-SI units accepted for use within the SI. For units that are composed of multiple parts, use the patterns as given in "A Primer for Communicating Mathematics via Plain Text" (https://cse.sc.edu/~fenner/latex-ASCII.pdf) by Stephen Fenner (e.g., `g/cm^3` for grams per cubic centimeter). For other units, provide the value as a recognizable standard (e.g., '%') or written out in full and in the plural (e.g., `individuals`). It is fine to provide non-SI units in the original language of the dataset.
Examples	`m` `g` `l` `s` `°C` `mm` `km²` `%` `hh:mm:ss`
Type	string
Format	default

assertionUnitIRI

Title (Label)	Assertion Unit IRI
Namespace	dwcdp
Table:	OrganismInteractionAssertion
Description	An IRI of a controlled vocabulary value for the units of an assertionValueNumeric.
Comments	Recommended best practice is to use an IRI for a term in a controlled vocabulary.
Type	string
Format	default

assertionUnitVocabulary

Title (Label)	Assertion Unit Vocabulary
Namespace	dwcdp
Table:	OrganismInteractionAssertion
Description	A reference to a controlled vocabulary in which the definition of the value in assertionUnit is given.
Type	string
Format	default

assertionBy

Title (Label)	Assertion By
Namespace	dwc
Table:	OrganismInteractionAssertion
IRI	http://rs.tdwg.org/dwc/terms/measurementDeterminedBy
Description	A list (concatenated and separated) of names of Agents responsible for making an Assertion.
Comments	Recommended best practice is to separate the values in a list with space vertical bar space ( \| ).
Examples	`José E. Crespo` `Oliver P. Pearson \| Anita K. Pearson` `FMNH` `bdqtestrunner`
Type	string
Format	default

assertionByID

Title (Label)	Assertion By ID
Namespace	dwcdp
Table:	OrganismInteractionAssertion
Description	An identifier for an Agent responsible for making an Assertion.
Comments	Recommended best practice is to use a globally unique identifier.
Examples	`https://orcid.org/0000-0002-1825-0097` (for an individual) `https://orcid.org/0000-0002-1825-0097 \| https://orcid.org/0000-0002-1825-0098` (for a list of people)
Type	string
Format	default

assertionProtocols

Title (Label)	Assertion Protocols
Namespace	dwcdp
Table:	OrganismInteractionAssertion
IRI	http://rs.tdwg.org/dwc/terms/measurementMethod
Description	Names of, references to, or descriptions of Protocols used in making an Assertion.
Type	string
Format	default

assertionProtocolID

Title (Label)	Assertion Protocol ID
Namespace	dwcdp
Table:	OrganismInteractionAssertion
IRI	http://rs.tdwg.org/dwc/iri/measurementMethod
Description	An identifier for a Protocol used to make an Assertion.
Type	string
Format	default

assertionReferences

Title (Label)	Assertion References
Namespace	dwcdp
Table:	OrganismInteractionAssertion
Description	A list (concatenated and separated) of identifiers (publication, bibliographic reference, global unique identifier, URI) of literature associated with an Assertion.
Comments	Recommended best practice is to separate the values in a list with space vertical bar space (` \| `).
Examples	`http://www.sciencemag.org/cgi/content/abstract/322/5899/261` `Christopher J. Conroy, Jennifer L. Neuwald. 2008. Phylogeographic study of the California vole, Microtus californicus Journal of Mammalogy, 89(3):755-767.` `Steven R. Hoofer and Ronald A. Van Den Bussche. 2001. Phylogenetic Relationships of Plecotine Bats and Allies Based on Mitochondrial Ribosomal Sequences. Journal of Mammalogy 82(1):131-137. \| Walker, Faith M., Jeffrey T. Foster, Kevin P. Drees, Carol L. Chambers. 2014. Spotted bat (Euderma maculatum) microsatellite discovery using illumina sequencing. Conservation Genetics Resources.`
Type	string
Format	default

assertionRemarks

Title (Label)	Assertion Remarks
Namespace	dwcdp
Table:	OrganismInteractionAssertion
IRI	http://rs.tdwg.org/dwc/terms/measurementRemarks
Description	Comments or notes about an Assertion.
Type	string
Format	default

PhylogeneticTreeAssertion

Identifier: http://rs.tdwg.org/dwc/dwc-dp/phylogenetic-tree-assertion

Description: An Assertion made by an Agent about a PhylogeneticTree.

Relationships to Other Tables

Field	Target Table	Target Field	Required
phylogeneticTreeID	phylogenetic-tree	phylogeneticTreeID	Yes
assertionByID	agent	agentID	No
assertionProtocolID	protocol	protocolID	No

assertionID

Title (Label)	Assertion ID
Namespace	dwc
Table:	PhylogeneticTreeAssertion
IRI	http://rs.tdwg.org/dwc/terms/measurementID
Description	An identifier for an Assertion.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': True}
Format	default

phylogeneticTreeID

Title (Label)	Phylogenetic Tree ID
Namespace	dwcdp
Table:	PhylogeneticTreeAssertion
Description	An identifier for a PhylogeneticTree.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

verbatimAssertionType

Title (Label)	Verbatim Assertion Type
Namespace	dwc
Table:	PhylogeneticTreeAssertion
IRI	http://rs.tdwg.org/dwc/terms/verbatimMeasurementType
Description	A string representing the type of Assertion as it appeared in the original record.
Comments	This term is meant to allow the capture of an unaltered original name for an Assertion type. This term is meant to be used in addition to dwc:assertionType, not instead of it.
Examples	`water_temp` `Fish biomass` `sampling net mesh size`
Type	string
Format	default

assertionType

Title (Label)	Assertion Type
Namespace	dwcdp
Table:	PhylogeneticTreeAssertion
Description	A category that best matches the nature of an Assertion.
Examples	`mass` `mean mass` `weight standard deviation` `minimum organism quantity` `Temperature of the water body` `salinity` `Mesh size of sample collector`
Type	string
Format	default

assertionTypeIRI

Title (Label)	Assertion Type IRI
Namespace	dwcdp
Table:	PhylogeneticTreeAssertion
Description	An IRI of a controlled vocabulary value for a type of Assertion.
Comments	Recommended best practice is to use an IRI for a term in a controlled vocabulary.
Examples	`http://vocab.nerc.ac.uk/collection/P01/current/TEMPPR01/` `http://vocab.nerc.ac.uk/collection/P01/current/SDBIOL05/` `http://vocab.nerc.ac.uk/collection/P01/current/MSHSIZE1/`
Type	string
Format	default

assertionTypeVocabulary

Title (Label)	Assertion Type Vocabulary
Namespace	dwcdp
Table:	PhylogeneticTreeAssertion
Description	A reference to the controlled vocabulary in which the definition of a value in assertionType is given.
Examples	http://vocab.nerc.ac.uk/collection/P01/current/
Type	string
Format	default

assertionMadeDate

Title (Label)	Assertion Made Date
Namespace	dwcdp
Table:	PhylogeneticTreeAssertion
Description	A date on which an Assertion was created.
Comments	Recommended best practice is to use a date that conforms to ISO 8601-1:2019.
Examples	`2024-07-29`
Type	string
Format	default

assertionEffectiveDate

Title (Label)	Assertion Effective Date
Namespace	dwcdp
Table:	PhylogeneticTreeAssertion
IRI	http://rs.tdwg.org/dwc/terms/measurementDeterminedDate
Description	A date on which a state or measurement of an Assertion was deemed to first be in effect.
Comments	Recommended best practice is to use a date that conforms to ISO 8601-1:2019.
Examples	`2024-07-29`
Type	string
Format	default

assertionValue

Title (Label)	Assertion Value
Namespace	dwcdp
Table:	PhylogeneticTreeAssertion
Description	An asserted value, if it is not numeric.
Examples	`UV-light`
Type	string
Format	default

assertionValueIRI

Title (Label)	Assertion Value IRI
Namespace	dwcdp
Table:	PhylogeneticTreeAssertion
Description	An IRI of the controlled vocabulary value for a value of an Assertion.
Comments	Recommended best practice is to use an IRI for a term in a controlled vocabulary.
Examples	`https://vocab.nerc.ac.uk/collection/S10/current/S103/`
Type	string
Format	default

assertionValueVocabulary

Title (Label)	Assertion Value Vocabulary
Namespace	dwcdp
Table:	PhylogeneticTreeAssertion
Description	A reference to a controlled vocabulary in which the definition of a value in assertionValue is given.
Examples	`https://vocab.nerc.ac.uk/collection/S10/current/`
Type	string
Format	default

assertionValueNumeric

Title (Label)	Assertion Value Numeric
Namespace	dwcdp
Table:	PhylogeneticTreeAssertion
Description	An asserted value, if it is numeric.
Examples	`0` `1` `14.5`
Type	number
Format	default

assertionUnit

Title (Label)	Assertion Unit
Namespace	dwcdp
Table:	PhylogeneticTreeAssertion
IRI	http://rs.tdwg.org/dwc/terms/measurementUnit
Description	Units associated with the value in assertionValueNumeric.
Comments	Recommended best practice is to use a controlled vocabulary such as the Ontology of Units of Measure http://www.wurvoc.org/vocabularies/om-1.8/ of SI units, derived units, or other non-SI units accepted for use within the SI. For units that are composed of multiple parts, use the patterns as given in "A Primer for Communicating Mathematics via Plain Text" (https://cse.sc.edu/~fenner/latex-ASCII.pdf) by Stephen Fenner (e.g., `g/cm^3` for grams per cubic centimeter). For other units, provide the value as a recognizable standard (e.g., '%') or written out in full and in the plural (e.g., `individuals`). It is fine to provide non-SI units in the original language of the dataset.
Examples	`m` `g` `l` `s` `°C` `mm` `km²` `%` `hh:mm:ss`
Type	string
Format	default

assertionUnitIRI

Title (Label)	Assertion Unit IRI
Namespace	dwcdp
Table:	PhylogeneticTreeAssertion
Description	An IRI of a controlled vocabulary value for the units of an assertionValueNumeric.
Comments	Recommended best practice is to use an IRI for a term in a controlled vocabulary.
Type	string
Format	default

assertionUnitVocabulary

Title (Label)	Assertion Unit Vocabulary
Namespace	dwcdp
Table:	PhylogeneticTreeAssertion
Description	A reference to a controlled vocabulary in which the definition of the value in assertionUnit is given.
Type	string
Format	default

assertionBy

Title (Label)	Assertion By
Namespace	dwc
Table:	PhylogeneticTreeAssertion
IRI	http://rs.tdwg.org/dwc/terms/measurementDeterminedBy
Description	A list (concatenated and separated) of names of Agents responsible for making an Assertion.
Comments	Recommended best practice is to separate the values in a list with space vertical bar space ( \| ).
Examples	`José E. Crespo` `Oliver P. Pearson \| Anita K. Pearson` `FMNH` `bdqtestrunner`
Type	string
Format	default

assertionByID

Title (Label)	Assertion By ID
Namespace	dwcdp
Table:	PhylogeneticTreeAssertion
Description	An identifier for an Agent responsible for making an Assertion.
Comments	Recommended best practice is to use a globally unique identifier.
Examples	`https://orcid.org/0000-0002-1825-0097` (for an individual) `https://orcid.org/0000-0002-1825-0097 \| https://orcid.org/0000-0002-1825-0098` (for a list of people)
Type	string
Format	default

assertionProtocols

Title (Label)	Assertion Protocols
Namespace	dwcdp
Table:	PhylogeneticTreeAssertion
IRI	http://rs.tdwg.org/dwc/terms/measurementMethod
Description	Names of, references to, or descriptions of Protocols used in making an Assertion.
Type	string
Format	default

assertionProtocolID

Title (Label)	Assertion Protocol ID
Namespace	dwcdp
Table:	PhylogeneticTreeAssertion
IRI	http://rs.tdwg.org/dwc/iri/measurementMethod
Description	An identifier for a Protocol used to make an Assertion.
Type	string
Format	default

assertionReferences

Title (Label)	Assertion References
Namespace	dwcdp
Table:	PhylogeneticTreeAssertion
Description	A list (concatenated and separated) of identifiers (publication, bibliographic reference, global unique identifier, URI) of literature associated with an Assertion.
Comments	Recommended best practice is to separate the values in a list with space vertical bar space (` \| `).
Examples	`http://www.sciencemag.org/cgi/content/abstract/322/5899/261` `Christopher J. Conroy, Jennifer L. Neuwald. 2008. Phylogeographic study of the California vole, Microtus californicus Journal of Mammalogy, 89(3):755-767.` `Steven R. Hoofer and Ronald A. Van Den Bussche. 2001. Phylogenetic Relationships of Plecotine Bats and Allies Based on Mitochondrial Ribosomal Sequences. Journal of Mammalogy 82(1):131-137. \| Walker, Faith M., Jeffrey T. Foster, Kevin P. Drees, Carol L. Chambers. 2014. Spotted bat (Euderma maculatum) microsatellite discovery using illumina sequencing. Conservation Genetics Resources.`
Type	string
Format	default

assertionRemarks

Title (Label)	Assertion Remarks
Namespace	dwcdp
Table:	PhylogeneticTreeAssertion
IRI	http://rs.tdwg.org/dwc/terms/measurementRemarks
Description	Comments or notes about an Assertion.
Type	string
Format	default

PhylogeneticTreeTipAssertion

Identifier: http://rs.tdwg.org/dwc/dwc-dp/phylogenetic-tree-tip-assertion

Description: An Assertion made by an Agent about a PhylogeneticTreeTip.

Relationships to Other Tables

Field	Target Table	Target Field	Required
phylogeneticTreeTipID	phylogenetic-tree-tip	phylogeneticTreeTipID	Yes
assertionByID	agent	agentID	No
assertionProtocolID	protocol	protocolID	No

assertionID

Title (Label)	Assertion ID
Namespace	dwc
Table:	PhylogeneticTreeTipAssertion
IRI	http://rs.tdwg.org/dwc/terms/measurementID
Description	An identifier for an Assertion.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': True}
Format	default

phylogeneticTreeTipID

Title (Label)	Phylogenetic Tree Tip ID
Namespace	dwcdp
Table:	PhylogeneticTreeTipAssertion
Description	An identifier for a PhylogeneticTreeTip.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

verbatimAssertionType

Title (Label)	Verbatim Assertion Type
Namespace	dwc
Table:	PhylogeneticTreeTipAssertion
IRI	http://rs.tdwg.org/dwc/terms/verbatimMeasurementType
Description	A string representing the type of Assertion as it appeared in the original record.
Comments	This term is meant to allow the capture of an unaltered original name for an Assertion type. This term is meant to be used in addition to dwc:assertionType, not instead of it.
Examples	`water_temp` `Fish biomass` `sampling net mesh size`
Type	string
Format	default

assertionType

Title (Label)	Assertion Type
Namespace	dwcdp
Table:	PhylogeneticTreeTipAssertion
Description	A category that best matches the nature of an Assertion.
Examples	`mass` `mean mass` `weight standard deviation` `minimum organism quantity` `Temperature of the water body` `salinity` `Mesh size of sample collector`
Type	string
Format	default

assertionTypeIRI

Title (Label)	Assertion Type IRI
Namespace	dwcdp
Table:	PhylogeneticTreeTipAssertion
Description	An IRI of a controlled vocabulary value for a type of Assertion.
Comments	Recommended best practice is to use an IRI for a term in a controlled vocabulary.
Examples	`http://vocab.nerc.ac.uk/collection/P01/current/TEMPPR01/` `http://vocab.nerc.ac.uk/collection/P01/current/SDBIOL05/` `http://vocab.nerc.ac.uk/collection/P01/current/MSHSIZE1/`
Type	string
Format	default

assertionTypeVocabulary

Title (Label)	Assertion Type Vocabulary
Namespace	dwcdp
Table:	PhylogeneticTreeTipAssertion
Description	A reference to the controlled vocabulary in which the definition of a value in assertionType is given.
Examples	http://vocab.nerc.ac.uk/collection/P01/current/
Type	string
Format	default

assertionMadeDate

Title (Label)	Assertion Made Date
Namespace	dwcdp
Table:	PhylogeneticTreeTipAssertion
Description	A date on which an Assertion was created.
Comments	Recommended best practice is to use a date that conforms to ISO 8601-1:2019.
Examples	`2024-07-29`
Type	string
Format	default

assertionEffectiveDate

Title (Label)	Assertion Effective Date
Namespace	dwcdp
Table:	PhylogeneticTreeTipAssertion
IRI	http://rs.tdwg.org/dwc/terms/measurementDeterminedDate
Description	A date on which a state or measurement of an Assertion was deemed to first be in effect.
Comments	Recommended best practice is to use a date that conforms to ISO 8601-1:2019.
Examples	`2024-07-29`
Type	string
Format	default

assertionValue

Title (Label)	Assertion Value
Namespace	dwcdp
Table:	PhylogeneticTreeTipAssertion
Description	An asserted value, if it is not numeric.
Examples	`UV-light`
Type	string
Format	default

assertionValueIRI

Title (Label)	Assertion Value IRI
Namespace	dwcdp
Table:	PhylogeneticTreeTipAssertion
Description	An IRI of the controlled vocabulary value for a value of an Assertion.
Comments	Recommended best practice is to use an IRI for a term in a controlled vocabulary.
Examples	`https://vocab.nerc.ac.uk/collection/S10/current/S103/`
Type	string
Format	default

assertionValueVocabulary

Title (Label)	Assertion Value Vocabulary
Namespace	dwcdp
Table:	PhylogeneticTreeTipAssertion
Description	A reference to a controlled vocabulary in which the definition of a value in assertionValue is given.
Examples	`https://vocab.nerc.ac.uk/collection/S10/current/`
Type	string
Format	default

assertionValueNumeric

Title (Label)	Assertion Value Numeric
Namespace	dwcdp
Table:	PhylogeneticTreeTipAssertion
Description	An asserted value, if it is numeric.
Examples	`0` `1` `14.5`
Type	number
Format	default

assertionUnit

Title (Label)	Assertion Unit
Namespace	dwcdp
Table:	PhylogeneticTreeTipAssertion
IRI	http://rs.tdwg.org/dwc/terms/measurementUnit
Description	Units associated with the value in assertionValueNumeric.
Comments	Recommended best practice is to use a controlled vocabulary such as the Ontology of Units of Measure http://www.wurvoc.org/vocabularies/om-1.8/ of SI units, derived units, or other non-SI units accepted for use within the SI. For units that are composed of multiple parts, use the patterns as given in "A Primer for Communicating Mathematics via Plain Text" (https://cse.sc.edu/~fenner/latex-ASCII.pdf) by Stephen Fenner (e.g., `g/cm^3` for grams per cubic centimeter). For other units, provide the value as a recognizable standard (e.g., '%') or written out in full and in the plural (e.g., `individuals`). It is fine to provide non-SI units in the original language of the dataset.
Examples	`m` `g` `l` `s` `°C` `mm` `km²` `%` `hh:mm:ss`
Type	string
Format	default

assertionUnitIRI

Title (Label)	Assertion Unit IRI
Namespace	dwcdp
Table:	PhylogeneticTreeTipAssertion
Description	An IRI of a controlled vocabulary value for the units of an assertionValueNumeric.
Comments	Recommended best practice is to use an IRI for a term in a controlled vocabulary.
Type	string
Format	default

assertionUnitVocabulary

Title (Label)	Assertion Unit Vocabulary
Namespace	dwcdp
Table:	PhylogeneticTreeTipAssertion
Description	A reference to a controlled vocabulary in which the definition of the value in assertionUnit is given.
Type	string
Format	default

assertionBy

Title (Label)	Assertion By
Namespace	dwc
Table:	PhylogeneticTreeTipAssertion
IRI	http://rs.tdwg.org/dwc/terms/measurementDeterminedBy
Description	A list (concatenated and separated) of names of Agents responsible for making an Assertion.
Comments	Recommended best practice is to separate the values in a list with space vertical bar space ( \| ).
Examples	`José E. Crespo` `Oliver P. Pearson \| Anita K. Pearson` `FMNH` `bdqtestrunner`
Type	string
Format	default

assertionByID

Title (Label)	Assertion By ID
Namespace	dwcdp
Table:	PhylogeneticTreeTipAssertion
Description	An identifier for an Agent responsible for making an Assertion.
Comments	Recommended best practice is to use a globally unique identifier.
Examples	`https://orcid.org/0000-0002-1825-0097` (for an individual) `https://orcid.org/0000-0002-1825-0097 \| https://orcid.org/0000-0002-1825-0098` (for a list of people)
Type	string
Format	default

assertionProtocols

Title (Label)	Assertion Protocols
Namespace	dwcdp
Table:	PhylogeneticTreeTipAssertion
IRI	http://rs.tdwg.org/dwc/terms/measurementMethod
Description	Names of, references to, or descriptions of Protocols used in making an Assertion.
Type	string
Format	default

assertionProtocolID

Title (Label)	Assertion Protocol ID
Namespace	dwcdp
Table:	PhylogeneticTreeTipAssertion
IRI	http://rs.tdwg.org/dwc/iri/measurementMethod
Description	An identifier for a Protocol used to make an Assertion.
Type	string
Format	default

assertionReferences

Title (Label)	Assertion References
Namespace	dwcdp
Table:	PhylogeneticTreeTipAssertion
Description	A list (concatenated and separated) of identifiers (publication, bibliographic reference, global unique identifier, URI) of literature associated with an Assertion.
Comments	Recommended best practice is to separate the values in a list with space vertical bar space (` \| `).
Examples	`http://www.sciencemag.org/cgi/content/abstract/322/5899/261` `Christopher J. Conroy, Jennifer L. Neuwald. 2008. Phylogeographic study of the California vole, Microtus californicus Journal of Mammalogy, 89(3):755-767.` `Steven R. Hoofer and Ronald A. Van Den Bussche. 2001. Phylogenetic Relationships of Plecotine Bats and Allies Based on Mitochondrial Ribosomal Sequences. Journal of Mammalogy 82(1):131-137. \| Walker, Faith M., Jeffrey T. Foster, Kevin P. Drees, Carol L. Chambers. 2014. Spotted bat (Euderma maculatum) microsatellite discovery using illumina sequencing. Conservation Genetics Resources.`
Type	string
Format	default

assertionRemarks

Title (Label)	Assertion Remarks
Namespace	dwcdp
Table:	PhylogeneticTreeTipAssertion
IRI	http://rs.tdwg.org/dwc/terms/measurementRemarks
Description	Comments or notes about an Assertion.
Type	string
Format	default

SurveyAssertion

Identifier: http://rs.tdwg.org/dwc/dwc-dp/survey-assertion

Description: An Assertion made by an Agent about a Survey.

Relationships to Other Tables

Field	Target Table	Target Field	Required
surveyID	survey	surveyID	Yes
assertionByID	agent	agentID	No
assertionProtocolID	protocol	protocolID	No

assertionID

Title (Label)	Assertion ID
Namespace	dwc
Table:	SurveyAssertion
IRI	http://rs.tdwg.org/dwc/terms/measurementID
Description	An identifier for an Assertion.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': True}
Format	default

surveyID

Title (Label)	Survey ID
Namespace	dwcdp
Table:	SurveyAssertion
Description	An identifier for a Survey.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

verbatimAssertionType

Title (Label)	Verbatim Assertion Type
Namespace	dwc
Table:	SurveyAssertion
IRI	http://rs.tdwg.org/dwc/terms/verbatimMeasurementType
Description	A string representing the type of Assertion as it appeared in the original record.
Comments	This term is meant to allow the capture of an unaltered original name for an Assertion type. This term is meant to be used in addition to dwc:assertionType, not instead of it.
Examples	`water_temp` `Fish biomass` `sampling net mesh size`
Type	string
Format	default

assertionType

Title (Label)	Assertion Type
Namespace	dwcdp
Table:	SurveyAssertion
Description	A category that best matches the nature of an Assertion.
Examples	`mass` `mean mass` `weight standard deviation` `minimum organism quantity` `Temperature of the water body` `salinity` `Mesh size of sample collector`
Type	string
Format	default

assertionTypeIRI

Title (Label)	Assertion Type IRI
Namespace	dwcdp
Table:	SurveyAssertion
Description	An IRI of a controlled vocabulary value for a type of Assertion.
Comments	Recommended best practice is to use an IRI for a term in a controlled vocabulary.
Examples	`http://vocab.nerc.ac.uk/collection/P01/current/TEMPPR01/` `http://vocab.nerc.ac.uk/collection/P01/current/SDBIOL05/` `http://vocab.nerc.ac.uk/collection/P01/current/MSHSIZE1/`
Type	string
Format	default

assertionTypeVocabulary

Title (Label)	Assertion Type Vocabulary
Namespace	dwcdp
Table:	SurveyAssertion
Description	A reference to the controlled vocabulary in which the definition of a value in assertionType is given.
Examples	http://vocab.nerc.ac.uk/collection/P01/current/
Type	string
Format	default

assertionMadeDate

Title (Label)	Assertion Made Date
Namespace	dwcdp
Table:	SurveyAssertion
Description	A date on which an Assertion was created.
Comments	Recommended best practice is to use a date that conforms to ISO 8601-1:2019.
Examples	`2024-07-29`
Type	string
Format	default

assertionEffectiveDate

Title (Label)	Assertion Effective Date
Namespace	dwcdp
Table:	SurveyAssertion
IRI	http://rs.tdwg.org/dwc/terms/measurementDeterminedDate
Description	A date on which a state or measurement of an Assertion was deemed to first be in effect.
Comments	Recommended best practice is to use a date that conforms to ISO 8601-1:2019.
Examples	`2024-07-29`
Type	string
Format	default

assertionValue

Title (Label)	Assertion Value
Namespace	dwcdp
Table:	SurveyAssertion
Description	An asserted value, if it is not numeric.
Examples	`UV-light`
Type	string
Format	default

assertionValueIRI

Title (Label)	Assertion Value IRI
Namespace	dwcdp
Table:	SurveyAssertion
Description	An IRI of the controlled vocabulary value for a value of an Assertion.
Comments	Recommended best practice is to use an IRI for a term in a controlled vocabulary.
Examples	`https://vocab.nerc.ac.uk/collection/S10/current/S103/`
Type	string
Format	default

assertionValueVocabulary

Title (Label)	Assertion Value Vocabulary
Namespace	dwcdp
Table:	SurveyAssertion
Description	A reference to a controlled vocabulary in which the definition of a value in assertionValue is given.
Examples	`https://vocab.nerc.ac.uk/collection/S10/current/`
Type	string
Format	default

assertionValueNumeric

Title (Label)	Assertion Value Numeric
Namespace	dwcdp
Table:	SurveyAssertion
Description	An asserted value, if it is numeric.
Examples	`0` `1` `14.5`
Type	number
Format	default

assertionUnit

Title (Label)	Assertion Unit
Namespace	dwcdp
Table:	SurveyAssertion
IRI	http://rs.tdwg.org/dwc/terms/measurementUnit
Description	Units associated with the value in assertionValueNumeric.
Comments	Recommended best practice is to use a controlled vocabulary such as the Ontology of Units of Measure http://www.wurvoc.org/vocabularies/om-1.8/ of SI units, derived units, or other non-SI units accepted for use within the SI. For units that are composed of multiple parts, use the patterns as given in "A Primer for Communicating Mathematics via Plain Text" (https://cse.sc.edu/~fenner/latex-ASCII.pdf) by Stephen Fenner (e.g., `g/cm^3` for grams per cubic centimeter). For other units, provide the value as a recognizable standard (e.g., '%') or written out in full and in the plural (e.g., `individuals`). It is fine to provide non-SI units in the original language of the dataset.
Examples	`m` `g` `l` `s` `°C` `mm` `km²` `%` `hh:mm:ss`
Type	string
Format	default

assertionUnitIRI

Title (Label)	Assertion Unit IRI
Namespace	dwcdp
Table:	SurveyAssertion
Description	An IRI of a controlled vocabulary value for the units of an assertionValueNumeric.
Comments	Recommended best practice is to use an IRI for a term in a controlled vocabulary.
Type	string
Format	default

assertionUnitVocabulary

Title (Label)	Assertion Unit Vocabulary
Namespace	dwcdp
Table:	SurveyAssertion
Description	A reference to a controlled vocabulary in which the definition of the value in assertionUnit is given.
Type	string
Format	default

assertionBy

Title (Label)	Assertion By
Namespace	dwc
Table:	SurveyAssertion
IRI	http://rs.tdwg.org/dwc/terms/measurementDeterminedBy
Description	A list (concatenated and separated) of names of Agents responsible for making an Assertion.
Comments	Recommended best practice is to separate the values in a list with space vertical bar space ( \| ).
Examples	`José E. Crespo` `Oliver P. Pearson \| Anita K. Pearson` `FMNH` `bdqtestrunner`
Type	string
Format	default

assertionByID

Title (Label)	Assertion By ID
Namespace	dwcdp
Table:	SurveyAssertion
Description	An identifier for an Agent responsible for making an Assertion.
Comments	Recommended best practice is to use a globally unique identifier.
Examples	`https://orcid.org/0000-0002-1825-0097` (for an individual) `https://orcid.org/0000-0002-1825-0097 \| https://orcid.org/0000-0002-1825-0098` (for a list of people)
Type	string
Format	default

assertionProtocols

Title (Label)	Assertion Protocols
Namespace	dwcdp
Table:	SurveyAssertion
IRI	http://rs.tdwg.org/dwc/terms/measurementMethod
Description	Names of, references to, or descriptions of Protocols used in making an Assertion.
Type	string
Format	default

assertionProtocolID

Title (Label)	Assertion Protocol ID
Namespace	dwcdp
Table:	SurveyAssertion
IRI	http://rs.tdwg.org/dwc/iri/measurementMethod
Description	An identifier for a Protocol used to make an Assertion.
Type	string
Format	default

assertionReferences

Title (Label)	Assertion References
Namespace	dwcdp
Table:	SurveyAssertion
Description	A list (concatenated and separated) of identifiers (publication, bibliographic reference, global unique identifier, URI) of literature associated with an Assertion.
Comments	Recommended best practice is to separate the values in a list with space vertical bar space (` \| `).
Examples	`http://www.sciencemag.org/cgi/content/abstract/322/5899/261` `Christopher J. Conroy, Jennifer L. Neuwald. 2008. Phylogeographic study of the California vole, Microtus californicus Journal of Mammalogy, 89(3):755-767.` `Steven R. Hoofer and Ronald A. Van Den Bussche. 2001. Phylogenetic Relationships of Plecotine Bats and Allies Based on Mitochondrial Ribosomal Sequences. Journal of Mammalogy 82(1):131-137. \| Walker, Faith M., Jeffrey T. Foster, Kevin P. Drees, Carol L. Chambers. 2014. Spotted bat (Euderma maculatum) microsatellite discovery using illumina sequencing. Conservation Genetics Resources.`
Type	string
Format	default

assertionRemarks

Title (Label)	Assertion Remarks
Namespace	dwcdp
Table:	SurveyAssertion
IRI	http://rs.tdwg.org/dwc/terms/measurementRemarks
Description	Comments or notes about an Assertion.
Type	string
Format	default

AgentIdentifier

Identifier: http://rs.tdwg.org/dwc/dwc-dp/agent-identifier

Description: An identifier for an Agent.

Examples:

`an ORCID`

`a Wikidata Q-number`

`an Index Herbariorum Institution Code`

`an International Standard Name Identifier`

Relationships to Other Tables

Field	Target Table	Target Field	Required
agentID	agent	agentID	Yes

identifier

Title (Label)	Identifier
Namespace	dcterms
Table:	AgentIdentifier
IRI	http://purl.org/dc/terms/identifier
Description	An unambiguous reference to a resource within a given context.
Comments	Recommended best practice is to identify a resource by means of a string conforming to a formal identification system.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

agentID

Title (Label)	Agent ID
Namespace	dwcdp
Table:	AgentIdentifier
Description	An identifier for an Agent.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

identifierType

Title (Label)	Identifier Type
Namespace	dwcdp
Table:	AgentIdentifier
Description	A category or system that best matches the nature of an Identifier.
Comments	Recommended best practice is to use a controlled vocabulary.
Type	string
Format	default

identifierTypeIRI

Title (Label)	Identifier Type IRI
Namespace	dwcdp
Table:	AgentIdentifier
Description	An IRI of a controlled vocabulary value for a type of Identifier.
Comments	Recommended best practice is to use an IRI for a term in a controlled vocabulary.
Type	string
Format	default

identifierTypeVocabulary

Title (Label)	Identifier Type Vocabulary
Namespace	dwcdp
Table:	AgentIdentifier
Description	A reference to a controlled vocabulary in which the definition of a value in identifierType is given.
Type	string
Format	default

identifierLanguage

Title (Label)	Identifier Language
Namespace	dwcdp
Table:	AgentIdentifier
Description	A language in which an Identifier is presented.
Comments	Recommended best prectice is to use an ISO639-2 three-letter language code.
Examples	`eng` (for Modern English) `spa` (for Castilian Standard Spanish)
Type	string
Format	default

EventIdentifier

Identifier: http://rs.tdwg.org/dwc/dwc-dp/event-identifier

Description: An identifier for a dwc:Event.

Relationships to Other Tables

Field	Target Table	Target Field	Required
eventID	event	eventID	Yes

identifier

Title (Label)	Identifier
Namespace	dcterms
Table:	EventIdentifier
IRI	http://purl.org/dc/terms/identifier
Description	An unambiguous reference to a resource within a given context.
Comments	Recommended best practice is to identify a resource by means of a string conforming to a formal identification system.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

eventID

Title (Label)	Event ID
Namespace	dwc
Table:	EventIdentifier
IRI	http://rs.tdwg.org/dwc/terms/eventID
Description	An identifier for a dwc:Event.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

identifierType

Title (Label)	Identifier Type
Namespace	dwcdp
Table:	EventIdentifier
Description	A category or system that best matches the nature of an Identifier.
Comments	Recommended best practice is to use a controlled vocabulary.
Type	string
Format	default

identifierTypeIRI

Title (Label)	Identifier Type IRI
Namespace	dwcdp
Table:	EventIdentifier
Description	An IRI of the controlled vocabulary value for a type of Identifier.
Comments	Recommended best practice is to use an IRI for a term in a controlled vocabulary.
Type	string
Format	default

identifierTypeVocabulary

Title (Label)	Identifier Type Vocabulary
Namespace	dwcdp
Table:	EventIdentifier
Description	A reference to a controlled vocabulary in which the definition of a value in identifierType is given.
Type	string
Format	default

identifierLanguage

Title (Label)	Identifier Language
Namespace	dwcdp
Table:	EventIdentifier
Description	A language in which an Identifier is presented.
Comments	Recommended best prectice is to use an ISO639-2 three-letter language code.
Examples	`eng` (for Modern English) `spa` (for Castilian Standard Spanish)
Type	string
Format	default

MaterialIdentifier

Identifier: http://rs.tdwg.org/dwc/dwc-dp/material-identifier

Description: An identifier for a dwc:MaterialEntity.

Relationships to Other Tables

Field	Target Table	Target Field	Required
materialEntityID	material	materialEntityID	Yes

identifier

Title (Label)	Identifier
Namespace	dcterms
Table:	MaterialIdentifier
IRI	http://purl.org/dc/terms/identifier
Description	An unambiguous reference to a resource within a given context.
Comments	Recommended best practice is to identify a resource by means of a string conforming to a formal identification system.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

materialEntityID

Title (Label)	Material Entity ID
Namespace	dwc
Table:	MaterialIdentifier
IRI	http://rs.tdwg.org/dwc/terms/materialEntityID
Description	An identifier for a dwc:MaterialEntity.
Comments	Values of dwc:materialEntityID are intended to uniquely and persistently identify a particular dwc:MaterialEntity within some context. Examples of context include a particular sample collection, an organization, or the worldwide scale. Recommended best practice is to use a persistent, globally unique identifier. The identifier is bound to a physical object (a dwc:MaterialEntity) as opposed to a particular digital record (representation) of that physical object.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

identifierType

Title (Label)	Identifier Type
Namespace	dwcdp
Table:	MaterialIdentifier
Description	A category or system that best matches the nature of an Identifier.
Comments	Recommended best practice is to use a controlled vocabulary.
Type	string
Format	default

identifierTypeIRI

Title (Label)	Identifier Type IRI
Namespace	dwcdp
Table:	MaterialIdentifier
Description	An IRI of a controlled vocabulary value for a type of Identifier.
Comments	Recommended best practice is to use an IRI for a term in a controlled vocabulary.
Type	string
Format	default

identifierTypeVocabulary

Title (Label)	Identifier Type Vocabulary
Namespace	dwcdp
Table:	MaterialIdentifier
Description	A reference to a controlled vocabulary in which the definition of a value in identifierType is given.
Type	string
Format	default

identifierLanguage

Title (Label)	Identifier Language
Namespace	dwcdp
Table:	MaterialIdentifier
Description	A language in which an Identifier is presented.
Comments	Recommended best prectice is to use an ISO639-2 three-letter language code.
Examples	`eng` (for Modern English) `spa` (for Castilian Standard Spanish)
Type	string
Format	default

MediaIdentifier

Identifier: http://rs.tdwg.org/dwc/dwc-dp/media-identifier

Description: An identifier for a Media entity.

Relationships to Other Tables

Field	Target Table	Target Field	Required
mediaID	media	mediaID	Yes

identifier

Title (Label)	Identifier
Namespace	dcterms
Table:	MediaIdentifier
IRI	http://purl.org/dc/terms/identifier
Description	An unambiguous reference to a resource within a given context.
Comments	Recommended best practice is to identify a resource by means of a string conforming to a formal identification system.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

mediaID

Title (Label)	Media ID
Namespace	dwcdp
Table:	MediaIdentifier
Description	An identifier for a Media instance.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

identifierType

Title (Label)	Identifier Type
Namespace	dwcdp
Table:	MediaIdentifier
Description	A category or system that best matches the nature of an Identifier.
Comments	Recommended best practice is to use a controlled vocabulary.
Type	string
Format	default

identifierTypeIRI

Title (Label)	Identifier Type IRI
Namespace	dwcdp
Table:	MediaIdentifier
Description	An IRI of a controlled vocabulary value for a type of Identifier.
Comments	Recommended best practice is to use an IRI for a term in a controlled vocabulary.
Type	string
Format	default

identifierTypeVocabulary

Title (Label)	Identifier Type Vocabulary
Namespace	dwcdp
Table:	MediaIdentifier
Description	A reference to a controlled vocabulary in which the definition of a value in identifierType is given.
Type	string
Format	default

identifierLanguage

Title (Label)	Identifier Language
Namespace	dwcdp
Table:	MediaIdentifier
Description	A language in which an Identifier is presented.
Comments	Recommended best prectice is to use an ISO639-2 three-letter language code.
Examples	`eng` (for Modern English) `spa` (for Castilian Standard Spanish)
Type	string
Format	default

OccurrenceIdentifier

Identifier: http://rs.tdwg.org/dwc/dwc-dp/occurrence-identifier

Description: An identifier for a dwc:Occurrence.

Relationships to Other Tables

Field	Target Table	Target Field	Required
occurrenceID	occurrence	occurrenceID	Yes

identifier

Title (Label)	Identifier
Namespace	dcterms
Table:	OccurrenceIdentifier
IRI	http://purl.org/dc/terms/identifier
Description	An unambiguous reference to a resource within a given context.
Comments	Recommended best practice is to identify a resource by means of a string conforming to a formal identification system.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

occurrenceID

Title (Label)	Occurrence ID
Namespace	dwc
Table:	OccurrenceIdentifier
IRI	http://rs.tdwg.org/dwc/terms/occurrenceID
Description	An identifier for a dwc:Occurrence.
Comments	Recommended best practice is to use a persistent, globally unique identifier. In the absence of a persistent global unique identifier, construct one from a combination of identifiers in the record that will most closely make a dwc:occurrenceID globally unique.
Examples	`http://arctos.database.museum/guid/MSB:Mamm:233627`
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

identifierType

Title (Label)	Identifier Type
Namespace	dwcdp
Table:	OccurrenceIdentifier
Description	A category or system that best matches the nature of an Identifier.
Comments	Recommended best practice is to use a controlled vocabulary.
Type	string
Format	default

identifierTypeIRI

Title (Label)	Identifier Type IRI
Namespace	dwcdp
Table:	OccurrenceIdentifier
Description	An IRI of a controlled vocabulary value for the type of Identifier.
Comments	Recommended best practice is to use an IRI for a term in a controlled vocabulary.
Type	string
Format	default

identifierTypeVocabulary

Title (Label)	Identifier Type Vocabulary
Namespace	dwcdp
Table:	OccurrenceIdentifier
Description	A reference to a controlled vocabulary in which the definition of a value in identifierType is given.
Type	string
Format	default

identifierLanguage

Title (Label)	Identifier Language
Namespace	dwcdp
Table:	OccurrenceIdentifier
Description	A language in which an Identifier is presented.
Comments	Recommended best prectice is to use an ISO639-2 three-letter language code.
Examples	`eng` (for Modern English) `spa` (for Castilian Standard Spanish)
Type	string
Format	default

PhylogeneticTreeIdentifier

Identifier: http://rs.tdwg.org/dwc/dwc-dp/phylogenetic-tree-identifier

Description: An identifier for a PhylogeneticTree.

Relationships to Other Tables

Field	Target Table	Target Field	Required
phylogeneticTreeID	phylogenetic-tree	phylogeneticTreeID	Yes

identifier

Title (Label)	Identifier
Namespace	dcterms
Table:	PhylogeneticTreeIdentifier
IRI	http://purl.org/dc/terms/identifier
Description	An unambiguous reference to a resource within a given context.
Comments	Recommended best practice is to identify a resource by means of a string conforming to a formal identification system.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

phylogeneticTreeID

Title (Label)	Phylogenetic Tree ID
Namespace	dwcdp
Table:	PhylogeneticTreeIdentifier
Description	An identifier for a PhylogeneticTree.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

identifierType

Title (Label)	Identifier Type
Namespace	dwcdp
Table:	PhylogeneticTreeIdentifier
Description	A category or system that best matches the nature of an Identifier.
Comments	Recommended best practice is to use a controlled vocabulary.
Type	string
Format	default

identifierTypeIRI

Title (Label)	Identifier Type IRI
Namespace	dwcdp
Table:	PhylogeneticTreeIdentifier
Description	An IRI of a controlled vocabulary value for the type of Identifier.
Comments	Recommended best practice is to use an IRI for a term in a controlled vocabulary.
Type	string
Format	default

identifierTypeVocabulary

Title (Label)	Identifier Type Vocabulary
Namespace	dwcdp
Table:	PhylogeneticTreeIdentifier
Description	A reference to a controlled vocabulary in which the definition of a value in identifierType is given.
Type	string
Format	default

identifierLanguage

Title (Label)	Identifier Language
Namespace	dwcdp
Table:	PhylogeneticTreeIdentifier
Description	A language in which an Identifier is presented.
Comments	Recommended best prectice is to use an ISO639-2 three-letter language code.
Examples	`eng` (for Modern English) `spa` (for Castilian Standard Spanish)
Type	string
Format	default

SurveyIdentifier

Identifier: http://rs.tdwg.org/dwc/dwc-dp/survey-identifier

Description: An identifier for a Survey.

Relationships to Other Tables

Field	Target Table	Target Field	Required
surveyID	survey	surveyID	Yes

identifier

Title (Label)	Identifier
Namespace	dcterms
Table:	SurveyIdentifier
IRI	http://purl.org/dc/terms/identifier
Description	An unambiguous reference to a resource within a given context.
Comments	Recommended best practice is to identify a resource by means of a string conforming to a formal identification system.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

surveyID

Title (Label)	Survey ID
Namespace	dwcdp
Table:	SurveyIdentifier
Description	An identifier for a Survey.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

identifierType

Title (Label)	Identifier Type
Namespace	dwcdp
Table:	SurveyIdentifier
Description	A category or system that best matches the nature of an Identifier.
Comments	Recommended best practice is to use a controlled vocabulary.
Type	string
Format	default

identifierTypeIRI

Title (Label)	Identifier Type IRI
Namespace	dwcdp
Table:	SurveyIdentifier
Description	An IRI of a controlled vocabulary value for a type of Identifier.
Comments	Recommended best practice is to use an IRI for a term in a controlled vocabulary.
Type	string
Format	default

identifierTypeVocabulary

Title (Label)	Identifier Type Vocabulary
Namespace	dwcdp
Table:	SurveyIdentifier
Description	A reference to a controlled vocabulary in which the definition of a value in identifierType is given.
Type	string
Format	default

identifierLanguage

Title (Label)	Identifier Language
Namespace	dwcdp
Table:	SurveyIdentifier
Description	A language in which an Identifier is presented.
Comments	Recommended best prectice is to use an ISO639-2 three-letter language code.
Examples	`eng` (for Modern English) `spa` (for Castilian Standard Spanish)
Type	string
Format	default

Relationship

Identifier: http://rs.tdwg.org/dwc/dwc-dp/relationship

Description: A specification for a relationship of a subject entity to a related entity.

relationshipID

Title (Label)	Relationship ID
Namespace	dwc
Table:	Relationship
IRI	http://rs.tdwg.org/dwc/terms/resourceRelationshipID
Description	An identifier for a Relationship.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': True}
Format	default

subjectResourceID

Title (Label)	Subject Resource ID
Namespace	dwc
Table:	Relationship
IRI	http://rs.tdwg.org/dwc/terms/resourceID
Description	An identifier for the resource that is the subject of a Relationship.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

subjectResourceType

Title (Label)	Subject Resource Type
Namespace	dwcdp
Table:	Relationship
Description	A category that best matches the nature of a subject resource.
Comments	Recommended best practice is to use a controlled vocabulary consisting of the classes of resources that can be related to each other.
Examples	`Agent` `ChronometricAge` `Collection` `Event` `GeneticSequence` `GeologicalContext` `Identification` `Identifier`` `Material` `Media` `Occurrence` `OrganismInteraction` `PhylogeneticTree` `PhylogeneticTreeTip` `Protocol` `Survey` `SurveyTarget`
Type	string
Format	default

subjectResourceTypeIRI

Title (Label)	Subject Resource Type IRI
Namespace	dwcdp
Table:	Relationship
Description	An IRI of a controlled vocabulary value for the type of a subject resource.
Comments	Recommended best practice is to use an IRI for a term in a controlled vocabulary.
Type	string
Format	default

subjectResourceTypeVocabulary

Title (Label)	Subject Resource Type Vocabulary
Namespace	dwcdp
Table:	Relationship
Description	A reference to a controlled vocabulary in which the definition of a value in subjectResourceType is given.
Type	string
Format	default

relationshipType

Title (Label)	Relationship Type
Namespace	dwc
Table:	Relationship
IRI	http://rs.tdwg.org/dwc/terms/relationshipOfResource
Description	A relationship of a subject resource (identified by subjectResourceID) to a related resource (identified by relatedResourceID).
Comments	Recommended best practice is to use a controlled vocabulary.
Type	string
Format	default

relationshipTypeIRI

Title (Label)	Relationship Type IRI
Namespace	dwcdp
Table:	Relationship
Description	An IRI of a controlled vocabulary value for the type of a Relationship.
Comments	Recommended best practice is to use an IRI for a term in a controlled vocabulary.
Type	string
Format	default

relationshipTypeVocabulary

Title (Label)	Relationship Type Vocabulary
Namespace	dwcdp
Table:	Relationship
Description	A reference to a controlled vocabulary in which the definition of a value in relationshipType is given.
Type	string
Format	default

relatedResourceID

Title (Label)	Related Resource ID
Namespace	dwc
Table:	Relationship
IRI	http://rs.tdwg.org/dwc/terms/relatedResourceID
Description	An identifier for the related resource (the object) of a Relationship.
Comments	Recommended best practice is to use a globally unique identifier.
Type	string
Constraints	{'required': True, 'unique': False}
Format	default

relatedResourceType

Title (Label)	Related Resource Type
Namespace	dwcdp
Table:	Relationship
Description	A category that best matches the nature of a related resource.
Comments	Recommended best practice is to use a controlled vocabulary consisting of the classes of resources that can be related to each other.
Examples	`Agent` `ChronometricAge` `Collection` `Event` `GeneticSequence` `GeologicalContext` `Identification` `Identifier`` `Material` `Media` `Occurrence` `OrganismInteraction` `PhylogeneticTree` `PhylogeneticTreeTip` `Protocol` `Survey` `SurveyTarget`
Type	string
Format	default

relatedResourceTypeIRI

Title (Label)	Related Resource Type IRI
Namespace	dwcdp
Table:	Relationship
Description	An IRI of a controlled vocabulary value for a type of related resource.
Comments	Recommended best practice is to use an IRI for a term in a controlled vocabulary.
Type	string
Format	default

relatedResourceTypeVocabulary

Title (Label)	Related Resource Type Vocabulary
Namespace	dwcdp
Table:	Relationship
Description	A reference to a controlled vocabulary in which the definition of a value in relatedResourceType is given.
Type	string
Format	default

relationshipOrder

Title (Label)	Relationship Order
Namespace	dwcdp
Table:	Relationship
Description	A numerical position of a Relationship in a set of Relationships that have the same combination of subjectResourceID, relatedResourceID, relationshipType, relationshipType, and relationshipTypeVocabulary.
Comments	One could use relationshipOrder to create an ordered list of authors for a Reference, for example. The first would have relationshipOrder=1, the second would have relationshipOrder=2.
Examples	`1` `2` `3`
Type	integer
Constraints	{'required': False, 'minimum': 1}
Format	default

relationshipAccordingTo

Title (Label)	Relationship According To
Namespace	dwc
Table:	Relationship
IRI	http://rs.tdwg.org/dwc/terms/relationshipAccordingTo
Description	A name of an Agent responsible for asserting a Relationship.
Examples	`José E. Crespo` `Oliver P. Pearson \| Anita K. Pearson` `FMNH`
Type	string
Format	default

relationshipAccordingToID

Title (Label)	Relationship According To ID
Namespace	dwcdp
Table:	Relationship
Description	An identifier for an Agent responsible for asserting a Relationship.
Comments	Recommended best practice is to use a globally unique identifier.
Examples	`https://orcid.org/0000-0002-1825-0097` `https://ror.org/00mh9zx15`
Type	string
Format	default

relationshipEffectiveDate

Title (Label)	Relationship Effective Date
Namespace	dwc
Table:	Relationship
IRI	http://rs.tdwg.org/dwc/terms/relationshipEstablishedDate
Description	A date on which a Relationship was established.
Comments	Recommended best practice is to use a date that conforms to ISO 8601-1:2019.
Examples	`14:07-06:00` (2:07pm in the time zone six hours earlier than UTC) `08:40:21Z` (8:40:21am UTC) `13:00:00Z/15:30:00Z` (the interval between 1pm UTC and 3:30pm UTC)
Type	string
Format	default

relationshipRemarks

Title (Label)	Relationship Remarks
Namespace	dwc
Table:	Relationship
IRI	http://rs.tdwg.org/dwc/terms/relationshipRemarks
Description	Comments or notes about a Relationship.
Type	string
Format	default

Table Relationships

Figure 1. Overview of the Darwin Core Data Package (DwC-DP), showing tables (classes) and their relationships to each other.

To explore the relationships between tables, see the Darwin Core Data Package Relationship Explorer.